The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products

ar1699 ARJ Research article The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products Elliott I James james.elliott@csc.mrc.ac.uk McVey H John john.mcvey@csc.mrc.ac.uk Higgins F Christopher christopher.higgins@csc.mrc.ac.uk

MRC Clinical Sciences Centre, Faculty of Medicine, Imperial College, Hammersmith Hospital Campus, London, UK

Arthritis Research & Therapy 1478-6354 2005 7 3 R468 R475 http://arthritis-research.com/content/7/3/R468 1589903310.1186/ar1699 20 10 2004 30 11 2004 18 1 2005 21 1 2005 21 2 2005 2005 Elliott et al., licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Systemic lupus erythematosus and its murine equivalent, modelled in the New Zealand Black and New Zealand White (NZB × NZW)F₁hybrid strain, are polygenic inflammatory diseases, probably reflecting an autoimmune response to debris from cells undergoing programmed cell death. Several human and murine loci contributing to disease have been defined. The present study asks whether the proinflammatory purinergic receptor P2X₇, an initiator of a form of programmed cell death known as aponecrosis, is a candidate product of murine and human lupus susceptibility loci. One such locus in (NZB × NZW)F₁mice is lbw3, which is situated at the distal end of NZW chromosome 5. We first assess whether NZB mice and NZW mice carry distinct alleles of the P2RX₇gene as expressed by common laboratory strains, which differ in sensitivity to ATP stimulation. We then compare the responses of NZB lymphocytes, NZW lymphocytes and (NZB × NZW)F₁lymphocytes to P2X₇stimulation. NZB and NZW parental strains express the distinct P2X₇-L and P2X₇-P alleles of P2RX₇, respectively, while lymphocytes from these and (NZB × NZW)F₁mice differ markedly in their responses to P2X₇receptor stimulation. NZB mice and NZW mice express functionally distinct alleles of the proinflammatory receptor, P2X₇. We show that current mapping suggests that murine and human P2RX₇receptor genes lie within lupus susceptibility loci lbw3 and SLEB4, and we argue that these encode a product with the functional characteristics consistent with a role in lupus. Furthermore, we argue that aponecrosis as induced by P2X₇is a cell death mechanism with characteristics that potentially have particular relevance to disease pathogenesis.

Introduction

Systemic lupus erythematosus (SLE) is a polygenic disease, although the genes contributing towards the disease are unknown. Several human susceptibility loci have been identified, with eight of the strongest candidates mapping to 1q23, 1q25-31, 1q41-42, 2q35-37, 4p16-15.2, 6p11-21, 12q24 and 16q12 1. Of the murine models, the New Zealand Black and New Zealand White (NZB × NZW)F₁hybrid strain is widely studied due to its similarity to human disease and its female preponderance. As with human SLE, the disorder of (NZB × NZW)F₁mice is polygenic with a contribution from both parents. In a study of (NZB × NZW)F₂mice, eight susceptibility loci were identified 2. In the case of the locus lbw3, at the distal region of chromosome 5, homozygosity for the NZW-derived locus was associated with increased mortality at 12 months. Although originally mapped to 88 cM on murine chromosome 5 2, more recent data locate the microsatellite used to define lbw3 at 81 cM (discussed later).

We have studied the properties of the proinflammatory purinergic receptor P2X₇, encoded by a gene within the human SLE locus SLEB4 3 at 12q24 (Ensembl Genome Browser: http://www.ensembl.org/Homo_sapiens/contigview?chr=12&vc_start=119982631&vc_end=1200highlight=ENSG00000089041) and by the murine lbw3 region (Ensembl Genome Browser: http://http:www.ensembl.org/Mus_musculus/contigview?&chr=5&vc_start=119870152&vc_end=11987), and discuss its potential role in disease. The P2X₇receptor belongs to a family of ion channels gated by extracellular ATP, but unlike other P2X receptors it is largely restricted to haematopoietic cells. The P2X₇receptor has been proposed to play a role in a variety of immune functions including the secretion of leaderless cytokines and the shedding of the lymphocyte homing receptor CD62L 4. As P2X₇-deficient mice exhibit resistance to antibody-induced arthritis and impaired CD62L shedding and IL-1β secretion 5, stimulation of this receptor is proinflammatory – suggesting a potential role in autoimmune disease.

In this respect, SLE is of particular interest. Not only is SLE an inflammatory disorder, but it probably reflects, at least in part, an immune response to debris of cells undergoing programmed cell death (PCD). As P2X₇stimulation is proinflammatory and induces PCD, functional polymorphisms in this gene would be predicted to affect lupus susceptibility. Moreover, PCD stimulated through the P2X₇receptor belongs to a category that bears many of the hallmarks of 'classic' caspase-dependent apoptosis, but also to other categories such as cytoplasmic vacuolization more often associated with necrosis. Such cell death has sometimes been termed 'aponecrosis' 6. Whereas removal of 'classic' apoptotic cells is believed to be immunologically silent, necrotic cell debris is proinflammatory 7. The effect of intermediate forms of PCD such as aponecrosis, for which clearance mechanisms have not been defined, is unknown, yet such material potentially plays a significant role in the pathogenesis of SLE (discussed later). Finally, P2X₇stimulation results in rapid translocation of phosphatidylserine (PS) from the inner to the outer leaflet of the plasma membrane, which is reversible if stimulation is brief (and thus independent of cell death). As PS and associated proteins are major targets of autoantibodies in SLE 8, cells stimulated via the P2X₇receptor may be a significant source of autoantigen in this disease.

An allelic variation (P451L) of the cytoplasmic domain of the P2X₇receptor in commonly used mouse strains is associated with significant differences in its sensitivity to the ATP ligand 9. These allelic forms with proline (P2X₇-P) and leucine (P2X₇-L) at position 451 confer high sensitivity and low sensitivity to stimulation by ATP, respectively. While the NZW strain has been shown to express the more responsive allele of P2X₇(P2X-P) 9, that expressed by the NZB strain is unknown. We show in the present article that NZB mice and NZW mice express different alleles of the proinflammatory receptor P2X₇, and furthermore that NZW lymphocytes are markedly more responsive to P2X₇stimulation than those from NZB mice. Lymphocytes from (NZB × NZW)F₁mice exhibited intermediate sensitivities to P2X₇-induced PS translocation and to PCD, but were as sensitive to induction of CD62L shedding as those from NZW mice, indicating a comparatively complex phenotypic penetration. The results indicate that P2X₇is a strong candidate for being the product of the murine lbw3 locus. As the human P2RX₇gene maps close to SLEB4, we hypothesize that similar polymorphisms may also contribute towards human disease.

Methods

Mice

Male mice were purchased from Harlan-Olac (Bicester, UK) and used at between 8 and 14 weeks. Institute guidelines for care of laboratory animals were followed. All studies received ethical review approval.

P2X₇PCRs

PCR amplification of the NZB mouse genomic sequence encompassing the T1352C polymorphism 9 was performed using the forward and reverse primers CCTGTCTAGGCTGTCCCTAT and GCTTATGGAAGAGCTTGGAG for 30 cycles. PCR products were cloned using the TOPO TA cloning system (Invitrogen, Paisley, UK). Forty-three independent clones were sequenced using an ABI PRISM Big Dye terminator ready reaction kit (Applied Biosystems, Warrington, UK) and were analysed on a 3700 DNA Analyser (Applied Biosystems). Nucleotide and amino acid substitutions were numbered using the cDNA sequence accession number NM-011027.

Reagents

Matrix metalloproteinase inhibitor III was from Calbiochem (Nottingham, UK). Other reagents were from Sigma (Poole, UK), unless stated. Diluents had no effect in any assay used.

Flow cytometry

Mesenteric lymphocyte cells (10⁷/ml) in phenol red-free DMEM were stained with a combination of CD4^APC, CD4^CYCHROME, CD4^PE, CD8^APC, CD8^CYCHROME, CD8^PE, CD8^FITCand CD62L^FITCantibodies (Becton Dickinson, Oxford, UK) as indicated, washed and resuspended in DMEM. Cells were equilibrated with annexin V^FITCor annexin V^CY5(Becton Dickinson) to assess cell surface PS exposure, or with propidium iodide for 4 min to assess cell death, and were analysed by flow cytometry on a FACScalibur machine using CellQuest (Becton Dickinson) or Flowjo (Tree Star, Ashland, OR, USA) software. Baseline fluorescence was established for approximately 1 min prior to addition of 150 μM (unless otherwise stated) 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP). Cells were monitored for PS exposure or CD62L shedding continuously in real time for up to 9 min or were monitored for uptake of propidium iodide, as indicated. All results are representative of at least three independent experiments.

IL-1β secretion

Spleens from NZW mice and NZB mice were disaggregated and erythrocytes were lysed (Puregene RBC lysis solution; Gentra Ltd, Minneapolis, MN, USA). Splenocytes (5 × 10⁶/ml) were then resuspended in DMEM supplemented with 10% FCS (Helena Biosciences, Sunderland, UK), and were stimulated with 2 μg/ml lipopolysaccharide. After 6 hours at 37°C the medium was removed and replaced with DMEM. Cells were then incubated at 37°C for 30 min with BzATP added as indicated. The supernatant was then collected and the cells and particulate matter were removed by centrifugation. Supernatants were then frozen at -20°C. IL-1β was quantified by ELISA (Quantikine mouse IL-1β kit; R&D Systems, Minneapolis, MN, USA) in accordance with the manufacturer's instructions. Statistical significance was measured by Student's t test.

Results

Real-time comparison of P2X₇-stimulated PS translocation and CD62L shedding by NZW, (NZB × NZW)F₁and NZB lymphocytes

We initially confirmed that NZW mice are homozygous for the P2X-P allele of P2RX₇9 associated with high sensitivity to stimulation, and we showed that NZB mice are homozygous for the low sensitivity allele P2X-L (data not shown). These forms differ at a single amino acid (451). P2X₇activation, stimulated by BzATP (Fig. 1), results in rapid externalization of PS and shedding of CD62L. We therefore developed real-time flow cytometric assays to directly compare the responses to P2X₇simulation of NZB lymphocytes, NZW lymphocytes and (NZB × NZW)F₁lymphocytes.

Figure 1

P2X₇-stimulated phosphatidylserine (PS) exposure on lymphocytes

P2X₇-stimulated phosphatidylserine (PS) exposure on lymphocytes. P2X₇-dependent exposure of PS on New Zealand Black (NZB) lymphocytes, New Zealand White (NZW) lymphocytes and (NZB × NZW)F₁(NZB/W) lymphocytes. To enable the direct comparison of responses of cells from NZB mice, NZW mice and (NZB × NZW)F₁mice in a single tube, lymphocytes from these strains were stained with anti-CD4^CYCHROME, anti-CD4^PEand anti-CD4^APC, respectively, mixed and equilibrated with annexin V^FITC. Thus labelled, cells could subsequently be distinguished by flow cytometric gating. Cells were stimulated with the P2X₇agonist 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP) at the time indicated by the arrow in (a). (a) Density plots of the rate of extracellular PS exposure in each cell population, as indicated by increased binding of annexin V^FITC. (b) Corresponding percentage of cells bearing exposed PS in each population at a single timepoint (indicated by boxes in (a)).

PS translocation

PS is largely confined to the inner leaflet of the plasma membrane in healthy cells. Loss of lipid asymmetry, as evidenced by surface exposure of PS occurring prior to membrane breakdown, is generally assumed to be a marker of PCD. To enable the direct comparison of responses of cells from NZB mice, NZW mice and (NZB × NZW)F₁mice in a single tube, lymphocytes from these three strains were stained with anti-CD4^CYCHROME, anti-CD4^PEand anti-CD4^APC, respectively, mixed and equilibrated with annexin V^FITC(to detect exposed PS). Labelled cells could thus subsequently be distinguished by flow cytometric gating. The rates of P2X₇-stimulated PS exposure by lymphocyte subsets derived from the three mouse strains were directly compared by real-time flow cytometry (Fig. 1). Baseline fluorescence was established, and cells were stimulated with the P2X₇agonist BzATP at the time indicated. The order of responsiveness to P2X₇stimulation, as evidenced by the percentage of cells translocating PS, was consistently NZW > (NZB × NZW)F₁> NZB. Therefore, consistent with the greater sensitivity of P2X₇-P, lymphocytes from NZW mice show greater sensitivity to P2X₇stimulation, and show co-dominance with the NZB-derived allele (P2X₇-L) in F₁hybrid mice.

CD62L shedding

Shedding of CD62L from T cells is a key event in lymphocyte migration to inflammatory sites 10 and is known to be induced by P2X₇stimulation. Lymphocytes from NZB mice, NZW mice and (NZB × NZW)F₁mice were differentially stained as already stated but were labelled with FITC-conjugated anti-CD62L in place of annexin V^FITCto allow direct comparison of the rate of CD62L shedding in a single tube. P2X₇-stimulated CD62L shedding was apparent as a decrease in fluorescence in the FL-1 channel. While the rates of P2X₇-stimulated CD62L shedding were high and low in NZW lymphocytes and NZB lymphocytes, respectively (Fig. 2), interestingly the rate of CD62L shedding by (NZB × NZW)F₁lymphocytes was indistinguishable from that by NZW cells. The high NZW response of P2X₇thus appears dominant with respect to CD62L shedding, indicating that factors downstream of P2X₇stimulation contribute to this phenotype. That loss of CD62L reflects shedding and not decreased cell surface expression through other mechanisms is evidenced by its blockade by an inhibitor of matrix metalloproteinase 11 (Fig. 2c).

Figure 2

P2X₇-stimulated shedding of CD62L by lymphocytes

P2X₇-stimulated shedding of CD62L by lymphocytes. To enable the direct comparison of responses of cells from New Zealand Black (NZB) mice, New Zealand White (NZW) mice and (NZB × NZW)F₁(NZB/W) mice in a single tube, lymphocytes from these strains were stained with anti-CD4^PE, anti-CD4^CYCHROMEand anti-CD4^APC, respectively, mixed and stained with anti-CD62L^FITC. Thus labelled, cells could subsequently be distinguished by flow cytometric gating. Cells were stimulated with the P2X₇agonist 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP) at the time indicated by the arrow in (a). (a) Density plots of the rate of CD62L shedding in each cell population, as indicated by decreased binding of anti-CD62L^FITC. (b) Corresponding levels of cell surface CD62L in each population (NZB, red line; NZW, green line; NZB/W, black line) immediately preceding P2X₇stimulation (indicated by left-hand gates in (a)) or 7 min after P2X₇stimulation (indicated by right-hand gates in (a)). (c) Effect of a broad inhibitor of metalloproteinases on loss of CD62L. Lymphocytes from NZW mice were stained with anti-CD4^CYCHROMEand anti-CD62L^PE, and the rate of loss of CD62L was assessed by flow cytometry. Cells were stimulated with BzATP in the presence or absence of 10 μM metalloproteinase inhibitor at the time indicated by an arrow. Shedding of CD62L is indicated by decreased binding of anti-CD62L^PE. MMP, matrix metallopoteinase.

P2X₇-induced secretion of IL-1β

Stimulation of the P2X₇receptor on lipopolysaccharide-stimulated monocytes and macrophages promotes secretion of the proinflammatory cytokine IL-1β 512, which may therefore be expected to differ between mice bearing P2X₇-L or P2X₇-P receptors. Indeed IL-1β secretion by NZW splenocytes stimulated in vitro with lipopolysaccharide and BzATP exceeded that by cells from NZB mice (P < 0.05 at 50, 100 and 150 μM BzATP; Fig. 3). Elevated IL-1β secretion by NZW splenocytes was apparent even in the absence of BzATP (although slightly below statistical significance), suggesting that inadvertent stimulation of the high (but not low) sensitivity P2X₇receptor may have occurred through cell death and the consequent release of ATP during cell preparation (spleen disaggregation and erythrocyte lysis). In one NZW splenocyte preparation exhibiting particularly high IL-1β secretion, cells were refractory to further stimulation of the P2X₇receptor in vitro.

Figure 3

P2X₇-stimulated secretion of IL-1β

P2X₇-stimulated secretion of IL-1β. Splenocytes were primed in vitro with lipopolysaccharide and were then stimulated with 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP) as indicated. The graph shows IL-1β secretion by cells from New Zealand Black mice (open squares) and New Zealand White mice (filled squares). Each line represents IL-1β secretion by cells from a single mouse.

P2X₇-induced PCD of NZW and NZB lymphocytes

Several lines of evidence indicate that lupus reflects an autoimmune response to debris from cells undergoing PCD. Although stimulation of P2X₇results in rapid PS translocation, the effects are reversible if exposure to the agonist is brief 4. Only prolonged treatment with agonist results in PCD. Translocation of PS following P2X₇activation cannot therefore be used as a direct measure of irreversible commitment to PCD. To measure PCD following prolonged P2X₇stimulation, we therefore compared the rate of terminal membrane breakdown (indicated by propidium iodide uptake) following BzATP treatment of NZW lymphocytes, NZB lymphocytes and (NZB × NZW)F₁lymphocytes (Fig. 4). P2X₇stimulation resulted in significant PCD in all populations tested, with the order of sensitivity NZW > (NZB × NZW)F₁> NZB, consistent with the high responder status of the NZW cells and the dominance of the NZW-derived P2RX₇allele in this response.

Figure 4

P2X₇-stimulated lymphocyte programmed cell death (PCD)

P2X₇-stimulated lymphocyte programmed cell death (PCD). Lymphocytes from New Zealand Black (NZB) mice, New Zealand White (NZW) mice and (NZB × NZW)F₁(NZB/W) mice were stained with anti-CD4^APCand anti-CD8^FITC, and were equilibrated with propidium iodide (PI). Panels show the mean percentage (± standard deviation, n = 5) of dead cells (those taking up PI) as assessed by flow cytometry before (t = 0), and at 15-min intervals subsequent to, stimulation of the P2X₇receptor with 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate. (a) CD4⁺cells, and (b) CD8⁺cells. NZB, open squares; NZW, open circles; NZB/W, open diamonds.

Discussion

Stimulation of the proinflammatory haematopoietic P2X₇receptor 5 results in IL-1β secretion, in high rates of PCD 4 and in CD62L shedding 13, each of which is associated with human SLE 141516. The P2X₇receptor therefore has the characteristics of a candidate lupus susceptibility gene product. Moreover, the gene encoding human P2X₇is located within a region (12q24; Ensembl Genome Browser: http://www.ensembl.org/Homo_sapiens/contigview?chr=12&vc_start=119982631&vc_end=1200highlight=ENSG00000089041) recently identified and confirmed in Hispanic and European-American Families as a lupus susceptibility locus, designated SLEB4 3.

A polymorphism in the cytoplasmic domain of the P2X₇receptor of common mouse strains is associated with differential responsiveness 9. While most strains, including NZW mice 9, possess proline in amino acid position 451, we showed that NZB mice express P2X₇with lysine at this position and that the variant confers markedly decreased sensitivity to P2X₇stimulation. Notably, the murine P2RX₇gene is encoded by a gene on chromosome 5 within a region designated lbw3 due to the identification of a NZW-derived susceptibility locus conferring increased mortality at 12 months 2. While susceptibility regions are broad, the microsatellite marker D5Mit101 (defining lbw3 2) was in the original study mapped to 88 cM on chromosome 5, which may have discouraged identification of P2RX₇as a candidate susceptibility gene. Current mapping data, however, show this marker located at 81 cM – Mouse Genome Informatics http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=markerDetail&key=6077a and Ensembl Genome Browser http://www.ensembl.org/Mus_musculus/markerview?marker=D5Mit101. As the marker D5Mit118 that is adjacent to P2RX₇is located at 67 cM – Ensembl Genome Browser http://http:www.ensembl.orMus_musculus/contigview?&chr=5&vc_start=119870152&vc_end=11987 and Mouse Genome Informatics http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=markil&key=6095 – the two are approximately 14 cM (or 19 Mb) apart (120 Mb versus 139 Mb), easily within the 20 cM distance used by Kono and colleagues 2 to define coverage by markers in their study.

Although gene polymorphisms may have unpredicted effects, other than P2RX₇there appear to be few candidate susceptibility genes (based on lymphoid expression and protein activity) in the region described by lbw3. However, other candidates might include those encoding: lnk, an adaptor protein in T-cell signalling (65.0 cM) 17; P2X₄, a purinergic receptor (65.0 cM) whose activity is assumed primarily to be neuronal, but which is also expressed (at least at the level of mRNA) in lymphocytes 18; shp2, a tyrosine phosphatase 19 (~66 cM [118.6 Mb]); and FLT3 (CD135, 82.0 cM), a tyrosine kinase expressed in haemaotopoietic cells 20. None of these has been reported to be polymorphic between NZB mice and NZW mice.

It is widely thought that lupus reflects an autoimmune response to cells undergoing PCD. Aberrant responses to such debris may reflect qualitative or quantitative abnormalities; for example, if its handling is defective and/or following exposure to increased levels of 'apoptotic' material. Both have been reported to contribute to human SLE 1516. That prolonged stimulation of the P2X₇receptor induces PCD is therefore of particular note. However, multiple pathways of PCD exist. While 'apoptosis' and 'PCD' are frequently used as synonyms, 'apoptosis' is often used to imply caspase-dependent cell death. Nevertheless, caspase involvement is not a good indicator of the physiologic importance, or 'programming', of a cell death pathway, and consequently classic 'apoptosis' may describe one end of a continuum of active PCD mechanisms 21. Hence, in principle, a defect in one of many PCD pathways, rather than increased susceptibility to PCD per se, may be sufficient to increased the burden of cellular debris and hence the susceptibility to lupus. Indeed, that SLE may reflect an autoimmune response to debris from 'apoptotic' cells, despite clearance of such material being thought generally immunologically silent 7, has been a conundrum.

To reconcile these findings it has been suggested that, in SLE, mechanisms for removing apoptotic debris are overloaded, with remaining cells undergoing secondary necrosis, and/or that apoptotic cells have some immunostimulatory properties 7. We suggest the additional possibility that different forms of PCD may give rise to debris with different degrees of immunogenicity. It is therefore necessary to dissect distinct PCD pathways to assess the potential effects that defects have on the disease process. It is attractive to speculate that P2X₇-induced aponecrotic debris, perhaps due to the catastrophic nature of its generation or the apparent differences in cell dismantling, may be more necrotic than apoptotic in character and thus be immunostimulatory. Such material may either promote responses to surrounding 'apoptotic' cells and/or directly stimulate autoimmune responses to itself (if lupus autoantigens are appropriately packaged in P2X₇-induced PCD). P2X₇receptor-induced PCD is therefore potentially a source of lupus autoantigens or may represent a catastrophic form of cell death that overwhelms the host's ability to clear such material.

We therefore suggest the following involvement of the P2X₇receptor in SLE. ATP exists at very high concentrations in normal cells (5–10 mM), and is released upon cell death before its rapid breakdown by ATPases. Consequently, extracellular concentrations of ATP, although normally low, are transiently increased at sites of tissue damage. Stimulation of P2X₇occurs at sufficient concentrations of ATP, resulting in secretion of IL-1β and in CD62L shedding within minutes. P2X₇stimulation thus acts to promote the inflammatory response. The resulting lymphoid infiltration leads to additional lymphocyte-mediated cell death, and to consequent ATP release, exacerbating the P2X₇-driven inflammatory cycle. Indeed, given sufficient tissue damage, prolonged stimulation of P2X₇itself induces PCD, further adding to the cycle of ATP release and destruction. Release of autoantigens within P2X₇-stimulated aponecrotic debris may also contribute to a breakdown in self-tolerance and initiation of autoimmunity.

While one must make the proviso that little is known at the moment about the level of ATP released at sites of tissue damage, its rate of decay and how these may vary between pathological conditions including SLE, we suggest it is reasonable to hypothesize that polymorphisms within P2X₇can influence the pathogenesis of lupus. Importantly, there are a number of polymorphisms within P2X₇that affect its activity. The Ile-568 to Asn 22, Arg307 to Gln 23, and Glu496 to Ala 24 polymorphisms therefore all result in reduced function of human P2X₇, and might each be hypothesized to result in decreased severity of SLE.

Conclusions

In summary, we have shown that polymorphism of the P2X₇receptor between NZW and NZB strains is associated with marked differences in P2X₇-stimulated proinflammatory responses, consistent with high responsiveness and low responsiveness previously reported for the two alleles. We also show that current genetic mapping indicates that the P2RX₇gene is located within the region defined as lbw3 and is a therefore a strong candidate for being the product of this lupus susceptibility locus. Furthermore, as the human gene maps very close to SLEB4, we hypothesize that polymorphisms within P2RX₇may also contribute to human disease. Stimulation of the P2X₇receptor is proinflammatory and induces a form of cell death known as aponecrosis, which exhibits several characteristics of apoptosis. We therefore suggest that the P2X₇receptor and gene have the functional and positional characteristics suggestive of a role in the pathogenesis in SLE, and that the potential of the cell death mechanism aponecrosis to contribute to disease warrants study.

Abbreviations

BzATP = 2'-3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate; DMEM = Dulbecco's modified Eagle's medium; ELISA = enzyme-linked immunosorbent assay; FCS = foetal calf serum; FITC = fluorescein isothiocyanate; IL = interleukin; NZB = New Zealand Black; NZW = New Zealand White; PCD = programmed cell death; PCR = polymerase chain reaction; PS = phosphatidylserine; SLE = systemic lupus erythematosus.

Competing interests

The author(s) declare there are no competing interests.

Authors' contributions

JIE conceived the study, carried out the flow cytometric and IL-1β secretion experiments, and wrote the first draft of the manuscript. JHM designed allele-specific primers and typed the P2RX₇genes of NZB mice and NZW mice, and contributed to drafting of the manuscript. CFH contributed to the design of experiments and drafting of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the Medical Research Council of Great Britain. The authors would like to thank Dr T Vyse for helpful discussions.

Update on human systemic lupus erythematosus genetics Tsao BP Curr Opin Rheumatol 2004 16 513 521 10.1097/01.bor.0000132648.62680.81 15314487 Lupus susceptibility loci in New Zealand mice Kono DH Burlingame RW Owens DG Kuramochi A Balderas RS Balomenos D Theofilopoulos AN Proc Natl Acad Sci 1994 91 10168 10172 44979 7937857 Linkage at 12q24 with systemic lupus erythematosus (SLE) is established and confirmed in Hispanic and European American families Nath SK Quintero-Del-Rio AI Kilpatrick J Feo L Ballesteros M Harley JB Am J Hum Genet 2004 74 73 82 10.1086/380913 14658095 Rapid secretion of interleukin-1beta by microvesicle shedding MacKenzie A Wilson HL Kiss-Toth E Dower SK North RA Surprenant A Immunity 2001 15 825 835 11728343 10.1016/S1074-7613(01)00229-1 Absence of the P2X7 receptor alters leukocyte function and attenuates an inflammatory response Labasi JM Petrushova N Donovan C McCurdy S Lira P Payette MM Brissette W Wicks JR Audoly L Gabel CA J Immunol 2002 168 6436 6445 12055263 Aponecrosis: morphological and biochemical exploration of a syncretic process of cell death sharing apoptosis and necrosis Formigli L Papucci L Tani A Schiavone N Tempestini A Orlandini GE Capaccioli S Orlandini SZ J Cell Physiol 2000 182 41 49 10.1002/(SICI)1097-4652(200001)182:1<41::AID-JCP5>3.0.CO;2-7 10567915 A blast from the past: clearance of apoptotic cells regulates immune responses Savill J Dransfield I Gregory C Haslett C Nat Rev Immunol 2002 2 965 975 10.1038/nri957 12461569 The prevalence, onset, and clinical significance of antiphospholipid antibodies prior to diagnosis of systemic lupus erythematosus McClain MT Arbuckle MR Heinlen LD Dennis GJ Roebuck J Rubertone MV Harley JB James JA Arthritis Rheum 2004 50 1226 1232 10.1002/art.20120 15077305 Cutting edge: a natural P451L mutation in the cytoplasmic domain impairs the function of the mouse P2X7 receptor Adriouch S Dox C Welge V Seman M Koch-Nolte F Haag F J Immunol 2002 169 4108 4112 12370338 A cell-surface molecule involved in organ-specific homing of lymphocytes Gallatin WM Weissman IL Butcher EC Nature 1983 304 30 34 10.1038/304030a0 6866086 Metalloproteinase-mediated regulation of L-selectin levels on leucocytes Preece G Murphy G Ager A J Biol Chem 1996 271 11634 11640 10.1074/jbc.271.20.11634 8662605 Pharmacological characterization of ATP- and LPS-induced IL-1beta release in human monocytes Grahames CB Michel AD Chessell IP Humphrey PP Br J Pharmacol 1999 127 1915 1921 10.1038/sj.bjp.0702732 10482924 Adenosine triphosphate-induced shedding of CD23 and L-selectin (CD62L) from lymphocytes is mediated by the same receptor but different metalloproteases Gu B Bendall LJ Wiley JS Blood 1998 92 946 951 9680363 Circulating P- and L-selectin and T-lymphocyte activation and patients with autoimmune rheumatic diseases Sfikakis PP Charalambopoulos D Vaiopoulos G Mavrikakis M Clin Rheumatol 1999 18 28 32 10.1007/s100670050047 10088945 Increased apoptotic neutrophils and macrophages and impaired macrophage phagocytic clearance of apoptotic neutrophils in systemic lupus erythematosus Ren Y Tang J Mok MY Chan AW Wu A Lau CS Arthritis Rheum 2003 48 2888 2897 10.1002/art.11237 14558095 Accelerated in vitro apoptosis of lymphocytes from patients with systemic lupus erythematosus Emlen W Niebur J Kadera R J Immunol 1994 152 3685 3692 8144943 Constitutive death of platelets leading to scavenger receptor-mediated phagocytosis. A caspase-independent cell clearance program Brown SB Clarke MC Magowan L Sanderson H Savill J J Biol Chem 2000 275 5987 5996 10.1074/jbc.275.8.5987 10681593 P2 receptor mRNA expression profiles in human lymphocytes, monocytes and CD34+stem and progenitor cells Wang L Jacobsen SE Bengtsson A Erlinge D BMC Immunol 2004 5 16 509419 15291969 10.1186/1471-2172-5-16 Subcellular localization of intracellular protein tyrosine phosphatases in T cells Gjorloff-Wingren A Saxena M Han S Wang X Alonso A Renedo M Oh P Williams S Schnitzer J Mustelin T Eur J Immunol 2000 30 2412 2421 10.1002/1521-4141(2000)30:8<2412::AID-IMMU2412>3.0.CO;2-J 10940933 Flt3 ligand preferentially increases the number of functionally active myeloid dendritic cells in the lungs of mice Masten BJ Olson GK Kusewitt DF Lipscomb MF J Immunol 2004 172 4077 4083 15034019 Caspase-independent cell death in T lymphocytes Jaattela M Tschopp J Nat Immunol 2003 4 416 423 10.1038/ni0503-416 12719731 An Ile-568 to Asn polymorphism prevents normal trafficking and function of the human P2X7 receptor Wiley JS Dao-Ung LP Li C Shemon AN Gu BJ Smart ML Fuller SJ Barden JA Petrou S Sluyter R J Biol Chem 2003 278 17108 17113 10.1074/jbc.M212759200 12586825 An Arg307 to Gln polymorphism within the ATP-binding site causes loss of function of the human P2X7 receptor Gu BJ Sluyter R Skarratt KK Shemon AN Dao-Ung LP Fuller SJ Barden JA Clarke AL Petrou S Wiley JS J Biol Chem 2004 279 31287 31295 10.1074/jbc.M313902200 15123679 P2X7 receptor polymorphism impairs extracellular adenosine 5' -triphosphate-induced interleukin-18 release from human monocytes Sluyter R Dalitz JG Wiley JS Genes Immun 2004 5 588 591 10.1038/sj.gene.6364127 15306849