<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>ar1993</ui>
	<ji>ARJ</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>Differential expression, function and response to inflammatory stimuli of 11&#946;-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation</p>
			</title>
			<aug>
				<au id="A1">
					<snm>Hardy</snm>
					<mi>S</mi>
					<fnm>Rowan</fnm>
					<insr iid="I1"/>
					<email>rxh484@bham.ac.uk</email>
				</au>
				<au id="A2">
					<snm>Filer</snm>
					<fnm>Andrew</fnm>
					<insr iid="I2"/>
					<email>A.Filer@bham.ac.uk</email>
				</au>
				<au id="A3">
					<snm>Cooper</snm>
					<mi>S</mi>
					<fnm>Mark</fnm>
					<insr iid="I1"/>
					<email>M.S.Cooper@bham.ac.uk</email>
				</au>
				<au id="A4">
					<snm>Parsonage</snm>
					<fnm>Greg</fnm>
					<insr iid="I2"/>
					<email>G.Parsonage@bham.ac.uk</email>
				</au>
				<au id="A5">
					<snm>Raza</snm>
					<fnm>Karim</fnm>
					<insr iid="I2"/>
					<email>K.Raza@bham.ac.uk</email>
				</au>
				<au id="A6">
					<snm>Hardie</snm>
					<mi>L</mi>
					<fnm>Debbie</fnm>
					<insr iid="I2"/>
					<email>D.L.Hardie@bham.ac.uk</email>
				</au>
				<au id="A7">
					<snm>Rabbitt</snm>
					<mi>H</mi>
					<fnm>Elizabeth</fnm>
					<insr iid="I1"/>
					<email>H.Rabbitt@bham.ac.uk</email>
				</au>
				<au id="A8">
					<snm>Stewart</snm>
					<mi>M</mi>
					<fnm>Paul</fnm>
					<insr iid="I1"/>
					<email>P.M.Stewart@bham.ac.uk</email>
				</au>
				<au id="A9">
					<snm>Buckley</snm>
					<mi>D</mi>
					<fnm>Christopher</fnm>
					<insr iid="I2"/>
					<email>C.D.Buckley@bham.ac.uk</email>
				</au>
				<au id="A10" ca="yes">
					<snm>Hewison</snm>
					<fnm>Martin</fnm>
					<insr iid="I3"/>
					<email>martin.hewison@cshs.org</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Division of Medical Sciences, Institute of Biomedical Research, The University of Birmingham Medical School, Birmingham, UK</p>
				</ins>
				<ins id="I2">
					<p>Division of Immunity and Infection, Institute of Biomedical Research, The University of Birmingham Medical School, Birmingham, UK</p>
				</ins>
				<ins id="I3">
					<p>Division of Endocrinology, Diabetes and Metabolism, Cedars-Sinai Medical Center, Los Angeles, California, USA</p>
				</ins>
			</insg>
			<source>Arthritis Research &amp; Therapy</source>
			<issn>1478-6354</issn>
			<pubdate>2006</pubdate>
			<volume>8</volume>
			<issue>4</issue>
			<fpage>R108</fpage>
			<url>http://arthritis-research.com/content/8/4/R108</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">16846535</pubid><pubid idtype="doi">10.1186/ar1993</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>7</day>
					<month>4</month>
					<year>2006</year>
				</date>
			</rec>
			<revreq>
				<date>
					<day>10</day>
					<month>5</month>
					<year>2006</year>
				</date>
			</revreq>
			<revrec>
				<date>
					<day>22</day>
					<month>5</month>
					<year>2006</year>
				</date>
			</revrec>
			<acc>
				<date>
					<day>19</day>
					<month>6</month>
					<year>2006</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>17</day>
					<month>7</month>
					<year>2006</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2006</year>
			<collab>Hardy et al.; licensee BioMed Central Ltd.</collab>
			<note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<p>Stromal cells such as fibroblasts play an important role in defining tissue-specific responses during the resolution of inflammation. We hypothesized that this involves tissue-specific regulation of glucocorticoids, mediated via differential regulation of the enzyme 11&#946;-hydroxysteroid dehydrogenase type 1 (11&#946;-HSD1). Expression, activity and function of 11&#946;-HSD1 was assessed in matched fibroblasts derived from various tissues (synovium, bone marrow and skin) obtained from patients with rheumatoid arthritis or osteoarthritis. 11&#946;-HSD1 was expressed in fibroblasts from all tissues but mRNA levels and enzyme activity were higher in synovial fibroblasts (2-fold and 13-fold higher mRNA levels in dermal and synovial fibroblasts, respectively, relative to bone marrow). Expression and activity of the enzyme increased in all fibroblasts following treatment with tumour necrosis factor-&#945; or IL-1&#946; (bone marrow: 8-fold and 37-fold, respectively, compared to vehicle; dermal fibroblasts: 4-fold and 14-fold; synovial fibroblasts: 7-fold and 31-fold; all <it>P </it>&lt; 0.01 compared with vehicle). Treatment with IL-4 or interferon-&#947; was without effect, and there was no difference in 11&#946;-HSD1 expression between fibroblasts (from any site) obtained from patients with rheumatoid arthritis or osteoarthritis. In the presence of 100 nmol/l cortisone, IL-6 production &#8211; a characteristic feature of synovial derived fibroblasts &#8211; was significantly reduced in synovial but not dermal or bone marrow fibroblasts. This was prevented by co-treatment with an 11&#946;-HSD inhibitor, emphasizing the potential for autocrine activation of glucocorticoids in synovial fibroblasts. These data indicate that differences in fibroblast-derived glucocorticoid production (via the enzyme 11&#946;-HSD1) between cells from distinct anatomical locations may play a key role in the predeliction of certain tissues to develop persistent inflammation.</p>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Introduction</p>
			</st>
			<p>The profound effects of glucocorticoids on the immune system have underpinned their widespread use as therapeutic agents for inflammatory diseases <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In addition to their therapeutic effects during pathological persistent inflammation, glucocorticoids are also known to play a key role in physiological responses directed at resolving inflammation at both systemic and tissue-specific levels <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. These effects are mediated at a molecular level by the nuclear glucocorticoid receptor (GR) <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, but recent studies have indicated that GR signalling is rheostatically regulated through tissue-specific metabolism of GR ligands. Specifically, the interconversion of active and inactive glucocorticoids is catalyzed by the enzyme 11&#946;-hydroxysteroid dehydrogenase type 1 (11&#946;-HSD1), which is located on the luminal surface of the endoplasmic reticulum <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. The bidirectional nature of 11&#946;-HSD1 means that it has capacity for both reductase (that is, conversion of inactive cortisone to active cortisol) and dehydrogenase (that is, cortisol to cortisone) metabolism. However, in most physiological settings the enzyme exhibits predominant reductase activity as a consequence of the coincident expression of hexose-6-phosphate dehydrogenase (H6PDH), which facilitates enhanced, localized concentration of the cofactor for 11&#946;-HSD1, namely NADPH (nicotinamide adenine dinucleotide phosphate, reduced form), within the endoplasmic reticulum lumen <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
			<p>Expression of 11&#946;-HSD1 occurs primarily in GR-rich tissues, where the enzyme acts to increase local levels of active glucocorticoids, thereby providing a system for autocrine induction of GR-mediated responses <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Prominent among these tissues is the liver, where glucocorticoids act as key metabolic regulators <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. However, the enzyme is also abundantly expressed by cells such as adipocytes <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr></abbrgrp>, osteoblasts <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>, myocytes <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp> and vascular cells <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, suggesting an additional role for 11&#946;-HSD1 as a determinant of glucocorticoid responses in mesenchymal cells. This includes effects on cell proliferation <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, differentiation <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B16">16</abbr></abbrgrp> and function <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, most notably in fat, where the enzyme appears to be a key facet of adipocyte differentiation <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp> and insulin sensitivity <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. The presence of 11&#946;-HSD1 in fibroblasts was previously documented <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>, particularly in the context of adipocyte differentiation <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Analysis of 11&#946;-HSD1 in adipose stromal cells has revealed significant variations in enzyme expression between fat depots from different localities, suggesting that the enzyme is an important factor in site-specific responses to glucocorticoids <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B22">22</abbr></abbrgrp>. However, the underlying impact of the enzyme in terms of mesenchymal stromal cell function has still to be fully defined. In studies presented here we examined site-specific expression of 11&#946;-HSD1 in fibroblasts and show that the resulting variations in glucocorticoid metabolism play an important role in defining fibroblast cell phenotype and their functional responses to inflammation.</p>
		</sec>
		<sec>
			<st>
				<p>Materials and methods</p>
			</st>
			<sec>
				<st>
					<p>Isolation and culture of human fibroblasts</p>
				</st>
				<p>All reagents used in cell culture were obtained from Sigma (Poole, UK) unless otherwise stated. Fibroblasts were isolated from biopsies of matched skin, bone marrow and synovium removed during total knee arthroplasty <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> from consenting patients who fulfilled the American College of Rheumatology (formally the American Rheumatism Association) criteria for rheumatoid arthritis (RA; <it>n </it>= 6) and osteoarthritis (OA; <it>n </it>= 3). Fibroblasts were isolated by mechanical digestion of tissue followed by dissociation in 5 mmol/l EDTA for 2 hours. Dissociated tissue was then washed and transferred to a culture flask. The fibroblasts were then cultured through to a maximum of seven passages in complete fibroblast medium consisting of RPMI-1640, 1% (vol/vol) non-essential amino acids, 1% penicillin/streptomycin, 1% sodium pyruvate, 2 mmol/l glutamine and 20% heat-inactivated foetal bovine serum (Labtech International, Sussex, UK) <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Fibroblasts were treated with 10 ng/ml IL-1, tumour necrosis factor (TNF)-&#945;, IL-4 and interferon-&#947; (R&amp;D Systems, Abingdon, UK) or 100 nmol/l cortisol or cortisone for 24 hours before harvesting.</p>
			</sec>
			<sec>
				<st>
					<p>Immunohistochemistry</p>
				</st>
				<p>Cryostat tissue sections of synovial tissue from patients with RA were analyzed using goat polyclonal antibodies to 11&#946;-HSD1 (The Binding Site, Birmingham, UK) with anti-sheep/goat biotin AB360 as secondary antibody (The Binding Site). Immunohistochemistry was also carried using polyclonal antisera to the following: the endothelial marker von Willebrand Factor (vWF; Dako, Ely, UK) with a secondary anti-rabbit AMCA antiserum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA); the fibroblast marker ASO2 (CD90) with a secondary anti-mouse IgG<sub>1 </sub>Alexa 633 antiserum (Invitrogen, Paisley, UK); and the UCHT-1 (CD3) antiserum (gift from Peter Beverly, UCL, London, UK) with secondary anti-mouse IgG<sub>2b </sub>TRITC (Southern Biotech, Birmingham, USA). Immunohistochemical analyses and subsequent image visualization were carried out as described previously <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>RNA extraction and reverse transcription</p>
				</st>
				<p>RNA was extracted from cultured fibroblasts using the single-step extraction method (TRI Reagent, Sigma, Poole, UK). Aliquots (1 &#956;g) of RNA were then reverse transcribed using random hexamers in a 20 &#956;l volume, as stated in the manufacturer's protocol (Promega, Madison, WI, USA) <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
			</sec>
			<sec>
				<st>
					<p>Real-time PCR</p>
				</st>
				<p>Expression of mRNA for 11&#946;-HSD1, H6PDH, GR&#945;, GR&#946;, IL-6, CCAAT/enhancer binding protein (C/EBP)&#945; and C/EBP&#946; was assessed using real-time PCR in an ABI 7500 system (Applied Biosytems, Warrington, UK). The reactions were performed in 25 &#956;l aliquots on a 96 well optical reaction plate (Sigma). Primers for 18S were used in conjunction with our target primers as an internal reference. Reactions contained TaqMan universal PCR master mix (Applied Biosytems), 900 nmol primers, 100&#8211;200 nmol TaqMan probe and 25&#8211;50 ng cDNA. Target genes probes were labelled with FAM and 18S probes were labelled with VIC. Reactions occurred as follows: 50&#176;C for 2 minutes, 95&#176;C for 10 minutes, 44 cycles of 95&#176;C for 15 seconds and 60&#176;C for 1 minutes. Data were obtained as Ct values (the cycle number at which logarithmic PCR plots cross a calculated threshold line) according to the manufacturer's guidelines (Applied Biosytems), and used to determine &#916;Ct values (Ct of target gene - Ct of housekeeping gene) as raw data for gene expression (high &#916;Ct = low gene expression). The fold change in gene expression was determined by subtracting &#916;Ct values for treated cells from their respective control samples. The resulting &#916;&#916;Ct values were then used to calculate fold change in gene expression according to the expression 2<sup>&#916;&#916;Ct</sup>. Probe and primer sequences used are summarized in Table <tblr tid="T1">1</tblr>.</p>
				<tbl id="T1" hint_layout="double">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>Probes and primer sequences used</p>
					</caption>
					<tblbdy cols="2">
						<r>
							<c ca="left">
								<p>Gene</p>
							</c>
							<c ca="left">
								<p>Primers and probes</p>
							</c>
						</r>
						<r>
							<c cspan="2">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>11&#946;-HSD1</p>
							</c>
							<c ca="left">
								<p>Forward primer: AGGAAAGCTCATGGGAGGACTAG</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: CATGCTCATTCTCAACCACATCACCAACA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>H6PDH</p>
							</c>
							<c ca="left">
								<p>Forward primer: CAGGTGTCCTAGTGCACATTGAC</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: GTAGCCCACTCTCTCGTCCAA</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: AAGGCACGCCCTCCCAGCG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>GR&#945;</p>
							</c>
							<c ca="left">
								<p>Forward primer: GCGATGGTCTCAGAAACCAAAC</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>GR&#946;</p>
							</c>
							<c ca="left">
								<p>Forward primer: AAC TGG CAG CGG TTT TAT CAA CT</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: TGT GTG AGA TGT GCT TTC TGG TT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>C/EBP&#945;</p>
							</c>
							<c ca="left">
								<p>Forward primer: TGGACAAGAACAGCAACGAG</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: TTGTCACTGGTCAGCTCCAG</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: CACCTTCTGCTGCGTCTCCACGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>C/EBP&#946;</p>
							</c>
							<c ca="left">
								<p>Forward primer: GACAAGCACAGCGACGAGTA</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Reverse primer: GTGCTGCGTCTCCAGGTT</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>Probe: ATCTTGGCCTTGTCGCGGCTCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>IL-6</p>
							</c>
							<c ca="left">
								<p>Assay on demand Hs00174131_m1 (ABI)</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>11&#946;-HSD1, 11&#946;-hydroxysteroid dehydrogenase type 1; C/EBP, CCAAT/enhancer binding protein; GR, glucocorticoid receptor; H6PDH, hexose-6-phosphate dehydrogenase.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>11&#946;-Hydroxysteroid dehydrogenase enzyme assays</p>
				</st>
				<p>Confluent cells in 12-well plates were cultured with 1 ml complete fibroblast medium, containing 100 nmol/l cortisone (to measure reductase activity) or cortisol (dehydrogenase activity) along with tritiated tracer for 18 hours. Steroids were extracted from growth medium using dichloromethane (5&#8211;10 vol) and separated by thin-layer chromatography (TLC) using ethanol:chloroform (8:92) as the mobile phase. TLC plates were analyzed using a Bioscan imaging detector (Bioscan, Washington, DC, USA) and the fractional conversion of steroids was calculated. In each case total protein concentration was assessed using a 96-well plate assay kit (Bio-Rad laboratories Inc., Hercules, CA, USA). Results were expressed as pmol product/hour per mg protein. All experiments were carried out in triplicate.</p>
			</sec>
			<sec>
				<st>
					<p>Analysis of IL-6 and cortisol levels by ELISA</p>
				</st>
				<p>Cortisol levels in supernatants from cultured cells were measured using a commercially available sandwich ELISA in accordance with the manufacturer's instructions (R&amp;D systems, Abingdon, UK). Data were expressed as pg cortisol/mg protein. Soluble IL-6 in supernatents from cultured cells was measured using a commercially available sandwich ELISA in accordance with the manufacturer's instructions (BD Biosciences Pharmingen, San Diego, CA, USA). Data were expressed as pg IL-6/mg protein.</p>
			</sec>
			<sec>
				<st>
					<p>Statistical analysis</p>
				</st>
				<p>Data are reported as mean &#177; standard deviation (SD) of replicate mean values for separate patient cell cultures. However, because of interindividual variation, data in Figures <figr fid="F1">1</figr> and <figr fid="F2">2</figr> are shown as representative means (&#177;SD) from single patient cell cultures. In these experiments assays were repeated at least twice using different cell preparations, with similar results. Regression analysis was performed using Microsoft Excel 2003. One-way analysis of variance was performed using SPSS Data Editor (SPSS Inc., Santa Clara, CA, USA).</p>
				<fig id="F1">
					<title>
						<p>Figure 1</p>
					</title>
					<caption>
						<p>Tissue-specific expression of 11&#946;-HSD1 is an autocrine determinant of cortisol levels in fibroblasts</p>
					</caption>
					<text>
						<p>Tissue-specific expression of 11&#946;-HSD1 is an autocrine determinant of cortisol levels in fibroblasts. Results are shown for cultures of dermal (DF), and bone marrow (BF) and synovial fibroblasts (SF). <b>(a) </b>Reductase activity determined by scanning thin layer chromatography (<sup>3</sup>H-cortisone to <sup>3</sup>H-cortisol conversion, 12-hour incubation) following treatment with IL-1 (10 ng/ml, 24 hours) or vehicle. <b>(b) </b>Accumulation of cortisol in cell culture medium (as determined by specific ELISA) from 100 nmol/l cortisone following treatment with TNF-&#945; (10 ng/ml, 24 hours) or vehicle. Values are expressed as mean &#177; standard deviation of four replicates from a representative culture of RA fibroblasts. Similar values were obtained when the assays were carried out using two other fibroblast cells lines. *<it>P </it>&lt; 0.01, **<it>P </it>&lt; 0.001 versus vehicle-treated cells; <sup>#</sup><it>P </it>&lt; 0.01 versus equivalent bone marrow fibroblasts; <sup>&amp;</sup><it>P </it>&lt; 0.01 versus equivalent dermal fibroblasts. ELISA, enzyme-linked immunosorbent assay; IL, interleukin; TNF, tumour necrosis factor; u.d., undetectable.</p>
					</text>
					<graphic file="ar1993-1" hint_layout="single"/>
				</fig>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>Autocrine activation of cortisol and the regulation of fibroblast function</p>
					</caption>
					<text>
						<p>Autocrine activation of cortisol and the regulation of fibroblast function. Bone marrow, dermal and synovial fibroblasts were treated with vehicle (C), cortisol (F), or cortisone (E; both at 100 nmol/l) in the presence or absence of the 11b-HSD1 inhibitor glycyrrhetinic acid (+ G; 5 &#956;mol/l) for 24 hours. Cells were then assessed expression of IL-6 mRNA and protein. <b>(a) </b>For mRNA analyses, target gene data were normalized for levels of the housekeeping gene 18S rRNA and presented as fold change in expression relative to vehicle-treated fibroblasts. <b>(b) </b>Analysis IL-6 protein secretion in synovial fibroblasts was carried out using a specific ELISA assay and reported as pg IL-6/mg cell protein/24 hours. Values are expressed as mean &#177; standard deviation of four replicates from a representative culture of rheumatoid arthritis fibroblasts. Similar values were obtained when the assays were carried out using two other fibroblast cells lines. *<it>P </it>&lt; 0.01, **<it>P </it>&lt; 0.001 versus vehicle-treated cells (statistical analysis carried out on unmodified &#916;Ct values). Ct = the cycle number at which logarithmic PCR plots cross a calculated threshold line; ELISA, enzyme-linked immunosorbent assay; 11&#946;-HSD = 11&#946;-hydroxysteroid dehydrogenase.</p>
					</text>
					<graphic file="ar1993-2" hint_layout="single"/>
				</fig>
				<p>We first examined whether synovial fibroblasts <it>in situ </it>expressed 11&#946;-HSD1. Confocal immunohistochemistry (Figure <figr fid="F3">3</figr>) indicated that 11&#946;-HSD1 was expressed by a variety of cells types in rheumatoid synovial tissue, including leukocytes such as T cells and macrophages. However, it was only weakly expressed by dendritic cells. The enzyme was abundantly expressed by CD90-positive fibroblasts and by endothelial cells (identified by von Willebrand factor staining).</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Expression of 11&#946;-HSD1 in synovial tissue</p>
					</caption>
					<text>
						<p>Expression of 11&#946;-HSD1 in synovial tissue. Co-localization of 11&#946;-HSD1 with markers of endothelial cells (vWF), fibroblasts (ASO2/CD90), T-cells (CD3), dendritic cells (CD11c) and lining macrophages (lining mac; CD68). Fluorescence immunohistochemistry was carried out using green, red and blue fluorescent tagged antiserum as shown in each panel. In each case the scale bar is 20 &#956;m. A indicates co-expression of 11&#946;-HSD1 and ASO2 (CD90) in fibroblasts; B highlights co-expression of 11&#946;-HSD1 and vWF in endothelial cells. 11&#946;-HSD, 11&#946;-hydroxysteroid dehydrogenase type 1; vWF, von Willebrand factor.</p>
					</text>
					<graphic file="ar1993-3" hint_layout="single"/>
				</fig>
				<p>To investigate the significance of 11&#946;-HSD1 expression in fibroblasts, further studies were carried out using primary cultures of fibroblasts isolated from matched synovium, bone marrow and skin. Analysis of mRNA from these cells indicated that expression of 11&#946;-HSD1 was greatest in synovial fibroblasts (&#916;Ct = 20.5 &#177; 2.2), followed by dermal (&#916;Ct = 23.3 &#177; 1.8) and bone marrow fibroblasts (&#916;Ct = 24.2 &#177; 0.9; Figure <figr fid="F4">4</figr>). In all three cell types expression of 11&#946;-HSD1 was upregulated after treatment with TNF-&#945; with the synovial fibroblasts (&#916;Ct = 17.7 &#177; 1.7) continuing to show the highest levels of mRNA relative to dermal (&#916;Ct = 18.9 &#177; 1.4) and bone marrow fibroblasts (&#916;Ct = 20.9 &#177; 1.2). These tissue-specific variations in baseline expression and potent inducibility by TNF-&#945; were not observed for other components of glucocorticoid metabolism and signalling. For example, the NADPH-generating enzyme H6PDH and GR&#945; exhibited similar levels of expression in the different fibroblast types, and this was not significantly affected by treatment with TNF-&#945; (Figure <figr fid="F4">4</figr>). The nonfunctional GR&#946; was only weakly expressed in basal fibroblasts compared with GR&#945; (&#916;Ct = 27.9 &#177; 2.1 in vehicle-treated versus 14.7 &#177; 1.9 for GR&#945;) and was also unaffected by TNF-&#945; treatment. Comparison of cells isolated from patients with RA (<it>n </it>= 6) with those from OA patients (<it>n </it>= 3) indicated that there was no significant difference in expression of 11&#946;-HSD1, H6PDH, GR&#945;, or GR&#946; mRNA in either vehicle or TNF-&#945;-treated fibroblasts between the two disease types (data not shown).</p>
				<fig id="F4">
					<title>
						<p>Figure 4</p>
					</title>
					<caption>
						<p>Site-specific variations in human fibroblastic 11&#946;-HSD1 expression versus other components of glucocorticoid metabolism and signalling</p>
					</caption>
					<text>
						<p>Site-specific variations in human fibroblastic 11&#946;-HSD1 expression versus other components of glucocorticoid metabolism and signalling. Expression of mRNA for <b>(a) </b>11&#946;-HSD1, <b>(b) </b>H6PDH, <b>(c) </b>GR&#945; and <b>(d) </b>GR&#946; in bone marrow (B), and dermal (D) and synovial (S) fibroblasts in the presence or absence of TNF-&#945; (10 ng/ml). For each gene product data were normalized for levels of the housekeeping gene 18S rRNA and are presented as fold change in expression relative to vehicle-treated bone marrow fibroblasts. *<it>P </it>&lt; 0.01 versus vehicle control; <sup>#</sup><it>P </it>&lt; 0.01 versus equivalent bone marrow fibroblasts; <sup>&amp;</sup><it>P </it>&lt; 0.01 versus equivalent dermal fibroblasts. 11&#946;-HSD, 11&#946;-hydroxysteroid dehydrogenase type 1; GR, glucocorticoid receptor; H6PDH, hexose-6-phosphate dehydrogenase; TNF, tumour necrosis factor.</p>
					</text>
					<graphic file="ar1993-4" hint_layout="single"/>
				</fig>
				<p>Similar induction of 11&#946;-HSD1 mRNA was seen with IL-1 in bone marrow (37-fold increase for IL-1 treatment and 8-fold increase for TNF-&#945; treatment relative to vehicle), dermal (14-fold and 4-fold increase) and synovial (31-fold and 7-fold) fibroblasts (Figure <figr fid="F5">5</figr>). By contrast, classical T-helper-1 and T-helper-2 cytokines such as interferon-&#947; and IL-4 and had no significant effect on 11&#946;-HSD1 expression in any of the fibroblasts.</p>
				<fig id="F5">
					<title>
						<p>Figure 5</p>
					</title>
					<caption>
						<p>Induction of 11&#946;-HSD1 expression is specific for inflammatory cytokines</p>
					</caption>
					<text>
						<p>Induction of 11&#946;-HSD1 expression is specific for inflammatory cytokines. <b>(a) </b>Bone marrow, and <b>(b) </b>dermal and <b>(c) </b>synovial fibroblasts (<it>n </it>= 3 for each) were cultured with or without TNF-&#945; (10 ng/ml), IL-1 (10 ng/ml), IFN-&#947; (100 iU), or IL-4 (10 ng/ml) for 24 hours. Total RNA from these cells was then used to assess expression of mRNA for 11&#946;-HSD1. In each case mRNA levels for 11&#946;-HSD1 were normalized for the housekeeping gene 18S rRNA and presented as fold change (mean &#177; standard deviation) in expression relative to vehicle treated bone marrow, dermal, or synovial fibroblasts. *<it>P </it>&lt; 0.05, **<it>P </it>&lt; 0.01 versus vehicle-treated cells. 11&#946;-HSD, 11&#946;-hydroxysteroid dehydrogenase type 1; C, control; IFN, interferon; IL, interleukin; TNF, tumour necrosis factor.</p>
					</text>
					<graphic file="ar1993-5" hint_layout="single"/>
				</fig>
				<p>The site-specific differences in fibroblastic 11&#946;-HSD1 mRNA expression and differential induction by IL-1 and TNF-&#945; were biologically relevant because they translated into differences in enzyme activity (Figure <figr fid="F1">1</figr>). Measurement of <sup>3</sup>H-cortisone and <sup>3</sup>H-cortisol metabolism by scanning analysis of TLC indicated predominant reductase activity in all three cell types, being highest in synovial fibroblasts, followed by bone marrow fibroblasts, and lowest in dermal fibroblasts (Figure <figr fid="F1">1a</figr>). Treatment with IL-1 (10 ng/ml, 24 hours) increased cortisol production in all three cell types at an order of magnitude that was similar to that seen for mRNA data (Figure <figr fid="F5">5</figr>). Further experiments were also carried out to confirm the predominant reductase activity (cortisone to cortisol conversion) of 11&#946;-HSD1 in human fibroblasts. ELISA data to assess the absolute levels of cortisol in cell culture supernatants revealed a pattern of 11&#946;-HSD1 activity similar to that determined by TLC analysis. Cortisol accumulation following 24 hours incubation with 100 nmol/l cortisone was again significantly higher in synovial fibroblasts and increased still further in cells that were pretreated with TNF-&#945; (Figure <figr fid="F1">1b</figr>).</p>
				<p>Previous studies have shown that members of the C/EBP family of transcription factors, namely C/EBP&#945; and C/EBP&#946;, are potent regulators of 11&#946;-HSD1 expression in hepatocytes <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. A similar association between 11&#946;-HSD1 and C/EBP&#945; and C/EBP&#946; was also observed in fibroblasts (Figure <figr fid="F6">6a</figr>), although levels of C/EBP&#946; were significantly higher than the &#945; isoform (higher &#916;Ct value = lower mRNA level). Both C/EBP&#945; and C/EBP&#946; exhibited tissue-specific variations in expression (Figure <figr fid="F6">6b</figr>): C/EBP&#945; was more strongly expressed in synovial fibroblasts, followed by bone marrow and then dermal fibroblasts, whereas the reverse pattern was observed for C/EBP&#946;.</p>
				<fig id="F6">
					<title>
						<p>Figure 6</p>
					</title>
					<caption>
						<p>Expression of 11&#946;-HSD1 in fibroblasts correlates with C/EBP&#945; and C/EBP&#946;</p>
					</caption>
					<text>
						<p>Expression of 11&#946;-HSD1 in fibroblasts correlates with C/EBP&#945; and C/EBP&#946;. <b>(a) </b>Correlation between &#916;Ct values for C/EBP&#945; and C/EBP&#946; with &#916;Ct values for 11&#946;-HSD1 in all fibroblast populations. <b>(b) </b>Fold change in C/EBP expression in bone marrow and synovial fibroblasts relative to dermal fibroblasts (mean &#177; standard deviation). *<it>P </it>&lt; 0.01 versus dermal and bone marrow fibroblasts (statistical analysis carried out on &#916;Ct values). C/EBP = CCAAT/enhancer binding protein; Ct = the cycle number at which logarithmic PCR plots cross a calculated threshold line; 11&#946;-HSD = 11&#946;-hydroxysteroid dehydrogenase.</p>
					</text>
					<graphic file="ar1993-6" hint_layout="single"/>
				</fig>
				<p>The functional significance of tissue-specific variations in glucocorticoid metabolism was investigated by determining whether increased 11&#946;-HSD1 activity was able to mediate autocrine regulation of the cytokine IL-6 in each of the different fibroblast types (Figure <figr fid="F2">2</figr>). Cortisol suppressed IL-6 mRNA levels in dermal (86%; <it>P </it>&lt; 0.01), bone marrow (50%; <it>P </it>&lt; 0.01) and synovial fibroblasts (87%; <it>P </it>&lt; 0.01), indicating that all three cells had a similar capacity for GR-mediated responsiveness (Figure <figr fid="F2">2a</figr>). However, only synovial fibroblasts suppressed IL-6 mRNA expression when treated with the inactive glucocorticoid cortisone. This was completely reversed in the presence of the 11&#946;-HSD inhibitor glycyrrhetinic acid, suggesting that cortisone achieves its effects on IL-6 via autocrine activation to cortisol (Figure <figr fid="F2">2a</figr>). Analysis of IL-6 protein secretion by ELISA in synovial fibroblasts confirmed that the findings observed at the RNA level were also reflected at the protein level. Because of variability in baseline IL-6 levels in different patients, data shown in Figure <figr fid="F2">2b</figr> were derived from a representative culture of RA fibroblasts. Similar results were observed in three sets of cells, and analysis of percentage change in IL-6 levels from these different cell preparations confirmed that in synovial fibroblasts both cortisol and cortisone were able to suppress IL-6 levels, with the effect of cortisone being abrogated by glycyrrhetinic acid (data not shown).</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Discussion</p>
			</st>
			<p>Fibroblasts and endothelial cells are able to influence immune responses through expression of specific cell adhesion molecules <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, cytokines <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and chemokines <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> that collectively define the parameters required for entry, proliferation, survival and exit of leukocytes in a particular tissue. This stromal-derived 'address code' plays a key role in the initiation and resolution of inflammation but it is also an important factor in the disordered leukocyte trafficking associated with chronic persistent inflammation <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. In previous reports we identified components of the stromal address code that are associated with specific tissues <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> and inflammatory responses <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Glucocorticoids are powerful endogenous modulators of inflammatory signal transduction <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>, and because their effects vary between tissues we hypothesized that components of glucocorticoid action may also contribute to the stromal address code. Data presented here suggest that one of these factors, namely the glucocorticoid-metabolizing enzyme 11&#946;-HSD1, is likely to play an important role in tissue-specific and inflammation-specific regulation of fibroblast function.</p>
			<p>The predominant GR isoform, GR&#945;, is ubiquitously expressed and mediates a wide range of responses to endogenous and exogenous glucocorticoids. Thus, dysregulated GR signalling is likely to be an integral component of persistent inflammation, and previous studies have associated glucocorticoid resistance with inflammatory disease <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. In the present study we could detect no difference in GR expression between tissues or in response to cytokine treatment. Instead, striking variations in expression were observed for the enzyme 11&#946;-HSD1, which exhibited cell-specific and cytokine-specific variations in expression and activity. Cytokine induction of stromal cell 11&#946;-HSD1 has previously been reported in adipocytes <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>, osteoblasts <abbrgrp><abbr bid="B33">33</abbr></abbrgrp> and amnion-derived fibroblasts <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. However, our data indicate that 11&#946;-HSD1 expression and function are also subject to significant tissue-specific variations. Differential expression of 11&#946;-HSD1 did not appear to be due to underlying inflammatory disease in donor RA patients, because similar observations were also made with cells from patients with OA. Furthermore, because fibroblasts from different sites were of matched donor origin, the effects of different exposure to drugs and disease duration can be excluded as confounding factors. It is possible that the method of fibroblast isolation could affect cell phenotype, but fibroblasts isolated in this way appear to maintain a pattern of gene expression to that seen <it>in vivo </it><abbrgrp><abbr bid="B34">34</abbr></abbrgrp>.</p>
			<p>There was a strong correlation between 11&#946;-HSD1 and the transcription factors C/EBP&#945; and C/EBP&#946;, which have been associated with hepatic expression of 11&#946;-HSD1 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. C/EBP&#946; has been shown to be constitutively activated in RA synovial tissue but it does not appear to be involved in IL-1-induced expression of IL-6 or IL-8, both of which are more closely linked to induction of nuclear factor-&#954;B <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. We also observed no significant alteration in C/EBP expression in cells treated with proinflammatory cytokines, but our data suggest that tissue-specific variations in 11&#946;-HSD1 may be dependent on the relative levels of C/EBP isoforms.</p>
			<p>Although 11&#946;-HSD1 is classically associated with hepatic glucocorticoid responses, its effects on stromal cells appear to be equally important as exemplified by the recent characterization of the adipocyte-specific transgenic mouse for 11&#946;-HSD1, the phenotype of which is profound obesity <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. In addition to this effect on mature cell function, the enzyme also appears to be intimately associated with stromal cell proliferation <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and differentiation <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Differential expression of fibroblastic 11&#946;-HSD1 may thus fulfil several functions. For example, the induction of the enzyme by IL-1 and TNF-&#945; may be part of an autocrine feedback mechanism regulating inflammatory signalling. Autocrine metabolism of glucocorticoids has been identified in several cell types associated with immune responses, including macrophages <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, dendritic cells <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, synoviocytes <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>, and lymphocytes <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. Each of these different cell types appears to utilize 11&#946;-HSD1 to attenuate distinct immune responses in an autocrine fashion <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B40">40</abbr></abbrgrp>, but the manner in which they are likely to interact in specific tissues remains unclear.</p>
			<p>One recent study <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> suggested that synthesis of cortisol is reduced in cells from RA patients when compared with their OA counterparts, suggesting that a decreased availability of anti-inflammatory cortisol may contribute to the development or persistence of RA. This study reported expression and activity of 11&#946;-HSD1 and suggested that this increased in response to inflammation, but the major difference between RA and OA tissues was the apparent expression of the glucocorticoid-inactivating enzyme 11&#946;-HSD2 in nonfibroblastic cells. Although the nature and origin of the 11&#946;-HSD2-expressing cells in RA is clearly of importance, it still appears that the normal response of synovial fibroblasts is to generate active glucocorticoids.</p>
			<p>Exogenous glucocorticoids have a dramatic effect on synovial inflammation but their use is limited by systemic side effects. The data presented here indicate that there is an endogenous local counterpart that may play an important role in regulating synovial inflammation. It is possible that this system is needed to counteract endogenous inflammatory regulators (such as macrophage migration inhibitory factor <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>) that are more highly expressed in synovium than in other tissues. It is also possible that impairment of local glucocorticoid generation will adversely affect the inflammatory response within the joint. Although we saw no difference in the capacity of synovial fibroblasts from patients with RA or OA to generate active glucocorticoids, it is possible that variations in the timing of this response may contribute to the pathogenesis or severity of inflammatory arthritis. For example, local metabolism of prednisone/prednisolone may partly explain the early dramatic response to therapy that occurs as a result of increased generation of active glucocorticoids in affected tissues. Future studies of 11&#946;-HSD1 <it>in vivo </it>will help to clarify its importance for the resolution, persistence and treatment of inflammation.</p>
		</sec>
		<sec>
			<st>
				<p>Conclusion</p>
			</st>
			<p>Stromal cells play a pivotal role in normal, physiological inflammation and persistent inflammatory disease by expressing factors such as cytokines and chemokines that define local immune responses. We postulate that endogenous activation of glucocorticoids via the enzyme 11&#946;-HSD1 is another important component of stromal cell function by providing an autocrine mechanism for the localized regulation of inflammation. Stromal cell 11&#946;-HSD1 may also play a key role in responses to therapeutic glucocorticoids by increasing their concentration in a tissue-specific manner.</p>
		</sec>
		<sec>
			<st>
				<p>Abbreviations</p>
			</st>
			<p>C/EBP = CCAAT/enhancer binding protein; Ct = the cycle number at which logarithmic PCR plots cross a calculated threshold line; ELISA = enzyme-linked immunosorbent assay; GR = glucocorticoid receptor; 11&#946;-HSD = 11&#946;-hydroxysteroid dehydrogenase; H6PDH = hexose-6-phosphate dehydrogenase; IL= interleukin; NADPH = nicotinamide adenine dinucleotide phosphate, reduced form; OA = osteoarthritis; PCR = polymerase chain reaction; RA = rheumatoid arthritis; SD = standard deviation; TLC = thin-layer chromatography; TNF = tumour necrosis factor.</p>
		</sec>
		<sec>
			<st>
				<p>Competing interests</p>
			</st>
			<p>The authors declare that they have no competing interests.</p>
		</sec>
		<sec>
			<st>
				<p>Authors' contributions</p>
			</st>
			<p>RSH cultured cells, extracted and analyzed RNA, and carried out enzyme activity studies. AF derived initial primary cultures. MSC developed initial hypothesis and co-wrote. GP derived initial primary cultures of fibroblasts. KR helped in the generation of cell lines and analyzed data. DLH carried out immunohistochemical analyses. EHR organized ELISA analyses. PMS developed initial hypothesis. CDB developed initial hypothesis, supervised collection of tissue and generation of cells, and co-wrote. MH developed initial hypothesis, supervised all cell analyses and co-wrote. All authors read and approved the final manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>Studies were funded by the Medical Research Council and the Arthritis Research Campaign. We would like to thank Dr Andrew Thomas at the Royal Orthopedic Hospital, Birmingham, UK for his help in organizing the collection of tissue biopsies.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>Antiinflammatory action of glucocorticoids &#8211; new mechanisms for old drugs</p>
				</title>
				<aug>
					<au>
						<snm>Rhen</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Cidlowski</snm>
						<fnm>JA</fnm>
					</au>
				</aug>
				<source>N Engl J Med</source>
				<pubdate>2005</pubdate>
				<volume>353</volume>
				<fpage>1711</fpage>
				<lpage>1723</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1056/NEJMra050541</pubid>
						<pubid idtype="pmpid" link="fulltext">16236742</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>Hypothalamic-pituitary-adrenal axis regulation of inflammation in rheumatoid arthritis</p>
				</title>
				<aug>
					<au>
						<snm>Morand</snm>
						<fnm>EF</fnm>
					</au>
					<au>
						<snm>Leech</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Immunol Cell Biol</source>
				<pubdate>2001</pubdate>
				<volume>79</volume>
				<fpage>395</fpage>
				<lpage>399</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1046/j.1440-1711.2001.01028.x</pubid>
						<pubid idtype="pmpid" link="fulltext">11488987</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Molecular control of immune/inflammatory responses: interactions between nuclear factor-kappa B and steroid receptor-signaling pathways</p>
				</title>
				<aug>
					<au>
						<snm>McKay</snm>
						<fnm>LI</fnm>
					</au>
					<au>
						<snm>Cidlowski</snm>
						<fnm>JA</fnm>
					</au>
				</aug>
				<source>Endocr Rev</source>
				<pubdate>1999</pubdate>
				<volume>20</volume>
				<fpage>435</fpage>
				<lpage>459</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/er.20.4.435</pubid>
						<pubid idtype="pmpid" link="fulltext">10453354</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>The glucocorticoid receptor: coding a diversity of proteins and responses through a single gene</p>
				</title>
				<aug>
					<au>
						<snm>Yudt</snm>
						<fnm>MR</fnm>
					</au>
					<au>
						<snm>Cidlowski</snm>
						<fnm>JA</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>2002</pubdate>
				<volume>16</volume>
				<fpage>1719</fpage>
				<lpage>1726</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.2002-0106</pubid>
						<pubid idtype="pmpid" link="fulltext">12145329</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glucocorticoid response</p>
				</title>
				<aug>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Bujalska</snm>
						<fnm>IJ</fnm>
					</au>
					<au>
						<snm>Draper</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Lavery</snm>
						<fnm>GG</fnm>
					</au>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>Endocr Rev</source>
				<pubdate>2004</pubdate>
				<volume>25</volume>
				<fpage>831</fpage>
				<lpage>866</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/er.2003-0031</pubid>
						<pubid idtype="pmpid" link="fulltext">15466942</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Minireview: 11beta-hydroxysteroid dehydrogenase type 1 &#8211; a tissue-specific amplifier of glucocorticoid action</p>
				</title>
				<aug>
					<au>
						<snm>Seckl</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>BR</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2001</pubdate>
				<volume>142</volume>
				<fpage>1371</fpage>
				<lpage>1376</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.142.4.1371</pubid>
						<pubid idtype="pmpid" link="fulltext">11250914</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Hexose-6-phosphate dehydrogenase confers oxo-reductase activity upon 11 beta-hydroxysteroid dehydrogenase type 1</p>
				</title>
				<aug>
					<au>
						<snm>Bujalska</snm>
						<fnm>IJ</fnm>
					</au>
					<au>
						<snm>Draper</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Michailidou</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>White</snm>
						<fnm>PC</fnm>
					</au>
					<au>
						<snm>Chapman</snm>
						<fnm>KE</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>J Mol Endocrinol</source>
				<pubdate>2005</pubdate>
				<volume>34</volume>
				<fpage>675</fpage>
				<lpage>684</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1677/jme.1.01718</pubid>
						<pubid idtype="pmpid" link="fulltext">15956339</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Growth hormone, insulin-like growth factor-I and the cortisol-cortisone shuttle</p>
				</title>
				<aug>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
					<au>
						<snm>Toogood</snm>
						<fnm>AA</fnm>
					</au>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
				</aug>
				<source>Horm Res</source>
				<pubdate>2001</pubdate>
				<volume>56</volume>
				<issue>Suppl 1</issue>
				<fpage>1</fpage>
				<lpage>6</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1159/000048126</pubid>
						<pubid idtype="pmpid" link="fulltext">11786677</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>The functional consequences of 11beta-hydroxysteroid dehydrogenase expression in adipose tissue</p>
				</title>
				<aug>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>Horm Metab Res</source>
				<pubdate>2002</pubdate>
				<volume>34</volume>
				<fpage>746</fpage>
				<lpage>751</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1055/s-2002-38242</pubid>
						<pubid idtype="pmpid" link="fulltext">12660893</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B10">
				<title>
					<p>11Beta-hydroxysteroid dehydrogenase type 1 in differentiating omental human preadipocytes: from de-activation to generation of cortisol</p>
				</title>
				<aug>
					<au>
						<snm>Bujalska</snm>
						<fnm>IJ</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>Endocr Res</source>
				<pubdate>2002</pubdate>
				<volume>28</volume>
				<fpage>449</fpage>
				<lpage>461</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1081/ERC-120016822</pubid>
						<pubid idtype="pmpid" link="fulltext">12530648</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>Osteoblastic 11beta-hydroxysteroid dehydrogenase type 1 activity increases with age and glucocorticoid exposure</p>
				</title>
				<aug>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Rabbitt</snm>
						<fnm>EH</fnm>
					</au>
					<au>
						<snm>Goddard</snm>
						<fnm>PE</fnm>
					</au>
					<au>
						<snm>Bartlett</snm>
						<fnm>WA</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>J Bone Miner Res</source>
				<pubdate>2002</pubdate>
				<volume>17</volume>
				<fpage>979</fpage>
				<lpage>986</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1359/jbmr.2002.17.6.979</pubid>
						<pubid idtype="pmpid" link="fulltext">12054173</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>11beta-Hydroxysteroid dehydrogenase in the heart of normotensive and hypertensive rats</p>
				</title>
				<aug>
					<au>
						<snm>Mazancova</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Kopecky</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Miksik</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Pacha</snm>
						<fnm>J</fnm>
					</au>
				</aug>
				<source>J Steroid Biochem Mol Biol</source>
				<pubdate>2005</pubdate>
				<volume>94</volume>
				<fpage>273</fpage>
				<lpage>277</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.jsbmb.2005.02.003</pubid>
						<pubid idtype="pmpid" link="fulltext">15862976</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>11beta-hydroxysteroid dehydrogenase activity in human aortic smooth muscle cells</p>
				</title>
				<aug>
					<au>
						<snm>Hatakeyama</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Inaba</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Miyamori</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Hypertens Res</source>
				<pubdate>2001</pubdate>
				<volume>24</volume>
				<fpage>33</fpage>
				<lpage>37</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1291/hypres.24.33</pubid>
						<pubid idtype="pmpid" link="fulltext">11213028</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B14">
				<title>
					<p>11beta-hydroxysteroid dehydrogenase in human vascular cells</p>
				</title>
				<aug>
					<au>
						<snm>Hatakeyama</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Inaba</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Takeda</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Miyamori</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Kidney Int</source>
				<pubdate>2000</pubdate>
				<volume>57</volume>
				<fpage>1352</fpage>
				<lpage>1357</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1046/j.1523-1755.2000.00974.x</pubid>
						<pubid idtype="pmpid" link="fulltext">10760066</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>Prereceptor regulation of glucocorticoid action by 11beta-hydroxysteroid dehydrogenase: a novel determinant of cell proliferation</p>
				</title>
				<aug>
					<au>
						<snm>Rabbitt</snm>
						<fnm>EH</fnm>
					</au>
					<au>
						<snm>Lavery</snm>
						<fnm>GG</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Faseb J</source>
				<pubdate>2002</pubdate>
				<volume>16</volume>
				<fpage>36</fpage>
				<lpage>44</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1096/fj.01-0582com</pubid>
						<pubid idtype="pmpid" link="fulltext">11772934</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>11beta-Hydroxysteroid dehydrogenase expression and glucocorticoid synthesis are directed by a molecular switch during osteoblast differentiation</p>
				</title>
				<aug>
					<au>
						<snm>Eijken</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>de Jong</snm>
						<fnm>FH</fnm>
					</au>
					<au>
						<snm>Chiba</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
					<au>
						<snm>Uitterlinden</snm>
						<fnm>AG</fnm>
					</au>
					<au>
						<snm>Pols</snm>
						<fnm>HA</fnm>
					</au>
					<au>
						<snm>van Leeuwen</snm>
						<fnm>JP</fnm>
					</au>
				</aug>
				<source>Mol Endocrinol</source>
				<pubdate>2005</pubdate>
				<volume>19</volume>
				<fpage>621</fpage>
				<lpage>631</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/me.2004-0212</pubid>
						<pubid idtype="pmpid" link="fulltext">15591536</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Increased expression of 11beta-hydroxysteroid dehydrogenase type 1 in type 2 diabetic myotubes</p>
				</title>
				<aug>
					<au>
						<snm>Abdallah</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Beck-Nielsen</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Gaster</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Eur J Clin Invest</source>
				<pubdate>2005</pubdate>
				<volume>35</volume>
				<fpage>627</fpage>
				<lpage>634</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1111/j.1365-2362.2005.01552.x</pubid>
						<pubid idtype="pmpid" link="fulltext">16178882</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B18">
				<title>
					<p>11beta-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice</p>
				</title>
				<aug>
					<au>
						<snm>Hermanowski-Vosatka</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Balkovec</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Cheng</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Chen</snm>
						<fnm>HY</fnm>
					</au>
					<au>
						<snm>Hernandez</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Koo</snm>
						<fnm>GC</fnm>
					</au>
					<au>
						<snm>Le Grand</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Li</snm>
						<fnm>Z</fnm>
					</au>
					<au>
						<snm>Metzger</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Mundt</snm>
						<fnm>SS</fnm>
					</au>
					<etal/>
				</aug>
				<source>J Exp Med</source>
				<pubdate>2005</pubdate>
				<volume>202</volume>
				<fpage>517</fpage>
				<lpage>527</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1084/jem.20050119</pubid>
						<pubid idtype="pmpid" link="fulltext">16103409</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>Light and electron microscopy localization of the 11beta-hydroxysteroid dehydrogenase type I enzyme in the rat</p>
				</title>
				<aug>
					<au>
						<snm>Brereton</snm>
						<fnm>PS</fnm>
					</au>
					<au>
						<snm>van Driel</snm>
						<fnm>RR</fnm>
					</au>
					<au>
						<snm>Suhaimi</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Koyama</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Dilley</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Krozowski</snm>
						<fnm>Z</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2001</pubdate>
				<volume>142</volume>
				<fpage>1644</fpage>
				<lpage>1651</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.142.4.1644</pubid>
						<pubid idtype="pmpid" link="fulltext">11250946</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>Enhancement of glucocorticoid-induced 11beta-hydroxysteroid dehydrogenase type 1 expression by proinflammatory cytokines in cultured human amnion fibroblasts</p>
				</title>
				<aug>
					<au>
						<snm>Sun</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Myatt</snm>
						<fnm>L</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2003</pubdate>
				<volume>144</volume>
				<fpage>5568</fpage>
				<lpage>5577</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.2003-0780</pubid>
						<pubid idtype="pmpid" link="fulltext">12960005</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Expression profiling during adipocyte differentiation of 3T3-L1 fibroblasts</p>
				</title>
				<aug>
					<au>
						<snm>Jessen</snm>
						<fnm>BA</fnm>
					</au>
					<au>
						<snm>Stevens</snm>
						<fnm>GJ</fnm>
					</au>
				</aug>
				<source>Gene</source>
				<pubdate>2002</pubdate>
				<volume>299</volume>
				<fpage>95</fpage>
				<lpage>100</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S0378-1119(02)01017-X</pubid>
						<pubid idtype="pmpid" link="fulltext">12459256</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>Expression of 11beta-hydroxysteroid dehydrogenase type 1 in adipose tissue is not increased in human obesity</p>
				</title>
				<aug>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Sinha</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Bujalska</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>J Clin Endocrinol Metab</source>
				<pubdate>2002</pubdate>
				<volume>87</volume>
				<fpage>5630</fpage>
				<lpage>5635</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/jc.2002-020687</pubid>
						<pubid idtype="pmpid" link="fulltext">12466364</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>A novel mechanism of neutrophil recruitment in a coculture model of the rheumatoid synovium</p>
				</title>
				<aug>
					<au>
						<snm>Lally</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Smith</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Filer</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Stone</snm>
						<fnm>MA</fnm>
					</au>
					<au>
						<snm>Shaw</snm>
						<fnm>JS</fnm>
					</au>
					<au>
						<snm>Nash</snm>
						<fnm>GB</fnm>
					</au>
					<au>
						<snm>Buckley</snm>
						<fnm>CD</fnm>
					</au>
					<au>
						<snm>Ed Rainger</snm>
						<fnm>G</fnm>
					</au>
				</aug>
				<source>Arthritis Rheum</source>
				<pubdate>2005</pubdate>
				<volume>52</volume>
				<fpage>3460</fpage>
				<lpage>3469</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/art.21394</pubid>
						<pubid idtype="pmpid" link="fulltext">16255036</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B24">
				<title>
					<p>A chemokine-dependent stromal induction mechanism for aberrant lymphocyte accumulation and compromised lymphatic return in rheumatoid arthritis</p>
				</title>
				<aug>
					<au>
						<snm>Burman</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Haworth</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Hardie</snm>
						<fnm>DL</fnm>
					</au>
					<au>
						<snm>Amft</snm>
						<fnm>EN</fnm>
					</au>
					<au>
						<snm>Siewert</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Jackson</snm>
						<fnm>DG</fnm>
					</au>
					<au>
						<snm>Salmon</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Buckley</snm>
						<fnm>CD</fnm>
					</au>
				</aug>
				<source>J Immunol</source>
				<pubdate>2005</pubdate>
				<volume>174</volume>
				<fpage>1693</fpage>
				<lpage>1700</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">15661933</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Differentiation of adipose stromal cells: the roles of glucocorticoids and 11beta-hydroxysteroid dehydrogenase</p>
				</title>
				<aug>
					<au>
						<snm>Bujalska</snm>
						<fnm>IJ</fnm>
					</au>
					<au>
						<snm>Kumar</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>1999</pubdate>
				<volume>140</volume>
				<fpage>3188</fpage>
				<lpage>3196</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.140.7.3188</pubid>
						<pubid idtype="pmpid" link="fulltext">10385414</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B26">
				<title>
					<p>C/EBP regulates hepatic transcription of 11beta-hydroxysteroid dehydrogenase type 1. A novel mechanism for cross-talk between the C/EBP and glucocorticoid signaling pathways</p>
				</title>
				<aug>
					<au>
						<snm>Williams</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Lyons</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>MacLeod</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Rajan</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Darlington</snm>
						<fnm>GJ</fnm>
					</au>
					<au>
						<snm>Poli</snm>
						<fnm>V</fnm>
					</au>
					<au>
						<snm>Seckl</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Chapman</snm>
						<fnm>KE</fnm>
					</au>
				</aug>
				<source>J Biol Chem</source>
				<pubdate>2000</pubdate>
				<volume>275</volume>
				<fpage>30232</fpage>
				<lpage>30239</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1074/jbc.M001286200</pubid>
						<pubid idtype="pmpid" link="fulltext">10906322</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B27">
				<title>
					<p>Cell-to-cell and cell-to-matrix interactions mediate chemokine expression: an important component of the inflammatory lesion</p>
				</title>
				<aug>
					<au>
						<snm>Smith</snm>
						<fnm>RE</fnm>
					</au>
					<au>
						<snm>Hogaboam</snm>
						<fnm>CM</fnm>
					</au>
					<au>
						<snm>Strieter</snm>
						<fnm>RM</fnm>
					</au>
					<au>
						<snm>Lukacs</snm>
						<fnm>NW</fnm>
					</au>
					<au>
						<snm>Kunkel</snm>
						<fnm>SL</fnm>
					</au>
				</aug>
				<source>J Leukoc Biol</source>
				<pubdate>1997</pubdate>
				<volume>62</volume>
				<fpage>612</fpage>
				<lpage>619</lpage>
				<xrefbib>
					<pubid idtype="pmpid">9365116</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B28">
				<title>
					<p>Immune-inflammatory functions of fibroblasts</p>
				</title>
				<aug>
					<au>
						<snm>Jordana</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Sarnstrand</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Sime</snm>
						<fnm>PJ</fnm>
					</au>
					<au>
						<snm>Ramis</snm>
						<fnm>I</fnm>
					</au>
				</aug>
				<source>Eur Respir J</source>
				<pubdate>1994</pubdate>
				<volume>7</volume>
				<fpage>2212</fpage>
				<lpage>2222</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1183/09031936.94.07122212</pubid>
						<pubid idtype="pmpid">7713206</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>Rheumatoid fibroblast-like synoviocytes overexpress the chemokine stromal cell-derived factor 1 (CXCL12), which supports distinct patterns and rates of CD4+ and CD8+ T cell migration within synovial tissue</p>
				</title>
				<aug>
					<au>
						<snm>Bradfield</snm>
						<fnm>PF</fnm>
					</au>
					<au>
						<snm>Amft</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Vernon-Wilson</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Exley</snm>
						<fnm>AE</fnm>
					</au>
					<au>
						<snm>Parsonage</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Rainger</snm>
						<fnm>GE</fnm>
					</au>
					<au>
						<snm>Nash</snm>
						<fnm>GB</fnm>
					</au>
					<au>
						<snm>Thomas</snm>
						<fnm>AM</fnm>
					</au>
					<au>
						<snm>Simmons</snm>
						<fnm>DL</fnm>
					</au>
					<au>
						<snm>Salmon</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Buckley</snm>
						<fnm>CD</fnm>
					</au>
				</aug>
				<source>Arthritis Rheum</source>
				<pubdate>2003</pubdate>
				<volume>48</volume>
				<fpage>2472</fpage>
				<lpage>2482</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/art.11219</pubid>
						<pubid idtype="pmpid" link="fulltext">13130466</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B30">
				<title>
					<p>Defining a role for fibroblasts in the persistence of chronic inflammatory joint disease</p>
				</title>
				<aug>
					<au>
						<snm>Buckley</snm>
						<fnm>CD</fnm>
					</au>
					<au>
						<snm>Filer</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Haworth</snm>
						<fnm>O</fnm>
					</au>
					<au>
						<snm>Parsonage</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Salmon</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Ann Rheum Dis</source>
				<pubdate>2004</pubdate>
				<volume>63</volume>
				<issue>Suppl 2</issue>
				<fpage>ii92</fpage>
				<lpage>ii95</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1136/ard.2004.028332</pubid>
						<pubid idtype="pmpid" link="fulltext">15479882</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B31">
				<title>
					<p>Global gene expression profiles in fibroblasts from synovial, skin and lymphoid tissue reveals distinct cytokine and chemokine expression patterns</p>
				</title>
				<aug>
					<au>
						<snm>Parsonage</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Falciani</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Burman</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Filer</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Ross</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Bofill</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Martin</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Salmon</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Buckley</snm>
						<fnm>CD</fnm>
					</au>
				</aug>
				<source>Thromb Haemost</source>
				<pubdate>2003</pubdate>
				<volume>90</volume>
				<fpage>688</fpage>
				<lpage>697</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">14515190</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B32">
				<title>
					<p>Regulation of expression of 11beta-hydroxysteroid dehydrogenase type 1 in adipose tissue: tissue-specific induction by cytokines</p>
				</title>
				<aug>
					<au>
						<snm>Tomlinson</snm>
						<fnm>JW</fnm>
					</au>
					<au>
						<snm>Moore</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Bujalska</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Shahmanesh</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Burt</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Strain</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>Endocrinology</source>
				<pubdate>2001</pubdate>
				<volume>142</volume>
				<fpage>1982</fpage>
				<lpage>1989</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1210/en.142.5.1982</pubid>
						<pubid idtype="pmpid" link="fulltext">11316764</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B33">
				<title>
					<p>Modulation of 11beta-hydroxysteroid dehydrogenase isozymes by proinflammatory cytokines in osteoblasts: an autocrine switch from glucocorticoid inactivation to activation</p>
				</title>
				<aug>
					<au>
						<snm>Cooper</snm>
						<fnm>MS</fnm>
					</au>
					<au>
						<snm>Bujalska</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Rabbitt</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>EA</fnm>
					</au>
					<au>
						<snm>Bland</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Sheppard</snm>
						<fnm>MC</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Stewart</snm>
						<fnm>PM</fnm>
					</au>
				</aug>
				<source>J Bone Miner Res</source>
				<pubdate>2001</pubdate>
				<volume>16</volume>
				<fpage>1037</fpage>
				<lpage>1044</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1359/jbmr.2001.16.6.1037</pubid>
						<pubid idtype="pmpid" link="fulltext">11393780</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B34">
				<title>
					<p>Fibroblast-like synoviocytes derived from patients with rheumatoid arthritis show the imprint of synovial tissue heterogeneity: evidence of a link between an increased myofibroblast-like phenotype and high-inflammation synovitis</p>
				</title>
				<aug>
					<au>
						<snm>Kasperkovitz</snm>
						<fnm>PV</fnm>
					</au>
					<au>
						<snm>Timmer</snm>
						<fnm>TC</fnm>
					</au>
					<au>
						<snm>Smeets</snm>
						<fnm>TJ</fnm>
					</au>
					<au>
						<snm>Verbeet</snm>
						<fnm>NL</fnm>
					</au>
					<au>
						<snm>Tak</snm>
						<fnm>PP</fnm>
					</au>
					<au>
						<snm>van Baarsen</snm>
						<fnm>LG</fnm>
					</au>
					<au>
						<snm>Baltus</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Huizinga</snm>
						<fnm>TW</fnm>
					</au>
					<au>
						<snm>Pieterman</snm>
						<fnm>E</fnm>
					</au>
					<au>
						<snm>Fero</snm>
						<fnm>M</fnm>
					</au>
					<etal/>
				</aug>
				<source>Arthritis Rheum</source>
				<pubdate>2005</pubdate>
				<volume>52</volume>
				<fpage>430</fpage>
				<lpage>441</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/art.20811</pubid>
						<pubid idtype="pmpid" link="fulltext">15692990</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B35">
				<title>
					<p>Regulation of IL-6 and IL-8 expression in rheumatoid arthritis synovial fibroblasts: the dominant role for NF-kappa B but not C/EBP beta or c-Jun</p>
				</title>
				<aug>
					<au>
						<snm>Georganas</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Liu</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Perlman</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Hoffmann</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Thimmapaya</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Pope</snm>
						<fnm>RM</fnm>
					</au>
				</aug>
				<source>J Immunol</source>
				<pubdate>2000</pubdate>
				<volume>165</volume>
				<fpage>7199</fpage>
				<lpage>7206</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11120852</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B36">
				<title>
					<p>A transgenic model of visceral obesity and the metabolic syndrome</p>
				</title>
				<aug>
					<au>
						<snm>Masuzaki</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Paterson</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Shinyama</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Morton</snm>
						<fnm>NM</fnm>
					</au>
					<au>
						<snm>Mullins</snm>
						<fnm>JJ</fnm>
					</au>
					<au>
						<snm>Seckl</snm>
						<fnm>JR</fnm>
					</au>
					<au>
						<snm>Flier</snm>
						<fnm>JS</fnm>
					</au>
				</aug>
				<source>Science</source>
				<pubdate>2001</pubdate>
				<volume>294</volume>
				<fpage>2166</fpage>
				<lpage>2170</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1126/science.1066285</pubid>
						<pubid idtype="pmpid" link="fulltext">11739957</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B37">
				<title>
					<p>11 Beta-hydroxysteroid dehydrogenase type 1 is induced in human monocytes upon differentiation to macrophages</p>
				</title>
				<aug>
					<au>
						<snm>Thieringer</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Le Grand</snm>
						<fnm>CB</fnm>
					</au>
					<au>
						<snm>Carbin</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Cai</snm>
						<fnm>TQ</fnm>
					</au>
					<au>
						<snm>Wong</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Wright</snm>
						<fnm>SD</fnm>
					</au>
					<au>
						<snm>Hermanowski-Vosatka</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>J Immunol</source>
				<pubdate>2001</pubdate>
				<volume>167</volume>
				<fpage>30</fpage>
				<lpage>35</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">11418628</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B38">
				<title>
					<p>Expression of 11beta-hydroxysteroid dehydrogenase type 1 permits regulation of glucocorticoid bioavailability by human dendritic cells</p>
				</title>
				<aug>
					<au>
						<snm>Freeman</snm>
						<fnm>L</fnm>
					</au>
					<au>
						<snm>Hewison</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Hughes</snm>
						<fnm>SV</fnm>
					</au>
					<au>
						<snm>Evans</snm>
						<fnm>KN</fnm>
					</au>
					<au>
						<snm>Hardie</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Means</snm>
						<fnm>TK</fnm>
					</au>
					<au>
						<snm>Chakraverty</snm>
						<fnm>R</fnm>
					</au>
				</aug>
				<source>Blood</source>
				<pubdate>2005</pubdate>
				<volume>106</volume>
				<fpage>2042</fpage>
				<lpage>2049</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1182/blood-2005-01-0186</pubid>
						<pubid idtype="pmpid" link="fulltext">15941907</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B39">
				<title>
					<p>Reduced capacity for the reactivation of glucocorticoids in rheumatoid arthritis synovial cells: possible role of the sympathetic nervous system?</p>
				</title>
				<aug>
					<au>
						<snm>Schmidt</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Weidler</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Naumann</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Anders</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Scholmerich</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Straub</snm>
						<fnm>RH</fnm>
					</au>
				</aug>
				<source>Arthritis Rheum</source>
				<pubdate>2005</pubdate>
				<volume>52</volume>
				<fpage>1711</fpage>
				<lpage>1720</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/art.21091</pubid>
						<pubid idtype="pmpid" link="fulltext">15934114</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B40">
				<title>
					<p>The expression of 11 beta-hydroxysteroid dehydrogenase type I by lymphocytes provides a novel means for intracrine regulation of glucocorticoid activities</p>
				</title>
				<aug>
					<au>
						<snm>Zhang</snm>
						<fnm>TY</fnm>
					</au>
					<au>
						<snm>Ding</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Daynes</snm>
						<fnm>RA</fnm>
					</au>
				</aug>
				<source>J Immunol</source>
				<pubdate>2005</pubdate>
				<volume>174</volume>
				<fpage>879</fpage>
				<lpage>889</lpage>
				<xrefbib>
					<pubid idtype="pmpid" link="fulltext">15634910</pubid>
				</xrefbib>
			</bibl>
			<bibl id="B41">
				<title>
					<p>Macrophage migration inhibitory factor: an emerging therapeutic target in rheumatoid arthritis</p>
				</title>
				<aug>
					<au>
						<snm>Morand</snm>
						<fnm>EF</fnm>
					</au>
					<au>
						<snm>Bucala</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Leech</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>Arthritis Rheum</source>
				<pubdate>2003</pubdate>
				<volume>48</volume>
				<fpage>291</fpage>
				<lpage>299</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/art.10728</pubid>
						<pubid idtype="pmpid" link="fulltext">12571836</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
		</refgrp>
	</bm>
</art>

