<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>ar2683</ui>
   <ji>ARJ</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Association of <it>MICA </it>with rheumatoid arthritis independent of known <it>HLA-DRB1 </it>risk alleles in a family-based and a case control study</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Kirsten</snm>
               <fnm>Holger</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <email>holgerkirsten@web.de</email>
            </au>
            <au id="A2">
               <snm>Petit-Teixeira</snm>
               <fnm>Elisabeth</fnm>
               <insr iid="I4"/>
               <email>epetit@polyarthrite.net</email>
            </au>
            <au id="A3">
               <snm>Scholz</snm>
               <fnm>Markus</fnm>
               <insr iid="I5"/>
               <email>markus.scholz@imise.uni-leipzig.de</email>
            </au>
            <au id="A4">
               <snm>Hasenclever</snm>
               <fnm>Dirk</fnm>
               <insr iid="I5"/>
               <email>dirk.hasenclever@imise.uni-leipzig.de</email>
            </au>
            <au id="A5">
               <snm>Hantmann</snm>
               <fnm>Helene</fnm>
               <insr iid="I2"/>
               <email>helene.hantmann@izi.fraunhofer.de</email>
            </au>
            <au id="A6">
               <snm>Heider</snm>
               <fnm>Dirk</fnm>
               <insr iid="I6"/>
               <email>dirk.heider@medizin.uni-leipzig.de</email>
            </au>
            <au id="A7">
               <snm>Wagner</snm>
               <fnm>Ulf</fnm>
               <insr iid="I7"/>
               <email>Ulf.Wagner@medizin.uni-leipzig.de</email>
            </au>
            <au id="A8">
               <snm>Sack</snm>
               <fnm>Ulrich</fnm>
               <insr iid="I2"/>
               <insr iid="I8"/>
               <email>Ulrich.Sack@medizin.uni-leipzig.de</email>
            </au>
            <au id="A9">
               <snm>Hugo Teixeira</snm>
               <fnm>Vitor</fnm>
               <insr iid="I4"/>
               <insr iid="I9"/>
               <email>vitor@polyarthrite.net</email>
            </au>
            <au id="A10">
               <snm>Prum</snm>
               <fnm>Bernard</fnm>
               <insr iid="I10"/>
               <email>prum@genopole.cnrs.fr</email>
            </au>
            <au id="A11">
               <snm>Burkhardt</snm>
               <fnm>Jana</fnm>
               <insr iid="I1"/>
               <email>Jana.Burkhardt@medizin.uni-leipzig.de</email>
            </au>
            <au id="A12">
               <snm>Pierlot</snm>
               <fnm>C&#233;line</fnm>
               <insr iid="I4"/>
               <email>cpierlot@yahoo.fr</email>
            </au>
            <au id="A13">
               <snm>Emmrich</snm>
               <fnm>Frank</fnm>
               <insr iid="I2"/>
               <insr iid="I3"/>
               <insr iid="I8"/>
               <email>Frank.Emmrich@medizin.uni-leipzig.de</email>
            </au>
            <au id="A14">
               <snm>Cornelis</snm>
               <fnm>Fran&#231;ois</fnm>
               <insr iid="I4"/>
               <insr iid="I11"/>
               <insr iid="I12"/>
               <email>francois.cornelis@lrb.aphp.fr</email>
            </au>
            <au id="A15" ca="yes">
               <snm>Ahnert</snm>
               <fnm>Peter</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <insr iid="I5"/>
               <email>peter.ahnert@gmx.net</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Center for Biotechnology and Biomedicine (BBZ), University of Leipzig, Deutscher Platz 5, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I2">
               <p>Translational Centre for Regenerative Medicine, University of Leipzig, Philipp-Rosenthal-Str. 55, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I3">
               <p>Fraunhofer Institute for Cell Therapy and Immunology IZI, Perlickstr. 1, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I4">
               <p>GenHotel-EA3886, Evry-Paris VII Universities, 2 rue Gaston Cr&#233;mieux, 91057 Evry-Genopole cedex, France</p>
            </ins>
            <ins id="I5">
               <p>Institute for Medical Informatics, Statistics and Epidemiology, University of Leipzig, H&#228;rtelstr. 16-18, 04107 Leipzig, Germany</p>
            </ins>
            <ins id="I6">
               <p>Health Economics Research Unit, Department of Psychiatry, University of Leipzig, Liebigstr. 26, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I7">
               <p>Medical Clinic and Polyclinic IV, University Hospital Leipzig, Liebigstr. 22, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I8">
               <p>Institute of Clinical Immunology and Transfusion Medicine, University of Leipzig, Johannisallee 30, 04103 Leipzig, Germany</p>
            </ins>
            <ins id="I9">
               <p>Faculty of Medicine, University of Coimbra, Rua Larga, 3004-504 Coimbra, Portugal</p>
            </ins>
            <ins id="I10">
               <p>Statistics and Genome laboratory, La genopole, 523 place des Terrasses, 91000 Evry, France</p>
            </ins>
            <ins id="I11">
               <p>H&#244;pital Sud Francilien, 59 Boulevard Henri Dunant, 91106 Corbeil-Essonnes cedex, France</p>
            </ins>
            <ins id="I12">
               <p>H&#244;pital Lariboisi&#232;re, AP-HP, 2 rue Ambroise &#8211; Par&#233;, 75475, Paris cedex 10, France</p>
            </ins>
         </insg>
         <source>Arthritis Research &amp; Therapy</source>
         <issn>1478-6354</issn>
         <pubdate>2009</pubdate>
         <volume>11</volume>
         <issue>3</issue>
         <fpage>R60</fpage>
         <url>http://arthritis-research.com/content/11/3/R60</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19409079</pubid>
               <pubid idtype="doi">10.1186/ar2683</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>23</day>
               <month>9</month>
               <year>2008</year>
            </date>
         </rec>
         <revreq>
            <date>
               <day>21</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </revreq>
         <revrec>
            <date>
               <day>14</day>
               <month>3</month>
               <year>2009</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>1</day>
               <month>5</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>1</day>
               <month>5</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Kirsten et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Introduction</p>
               </st>
               <p>The gene <it>MICA </it>encodes the protein major histocompatibility complex class I polypeptide-related sequence A. It is expressed in synovium of patients with rheumatoid arthritis (RA) and its implication in autoimmunity is discussed. We analyzed the association of genetic variants of <it>MICA </it>with susceptibility to RA.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>Initially, 300 French Caucasian individuals belonging to 100 RA trio families were studied. An additional 100 independent RA trio families and a German Caucasian case-control cohort (90/182 individuals) were available for replication. As <it>MICA </it>is situated in proximity to known risk alleles of the <it>HLA-DRB1 </it>locus, our analysis accounted for linkage disequilibrium either by analyzing the subgroup consisting of parents not carrying <it>HLA-DRB1 </it>risk alleles with transmission disequilibrium test (TDT) or by implementing a regression model including all available data. Analysis included a microsatellite polymorphism (GCT)n and single-nucleotide polymorphisms (SNPs) rs3763288 and rs1051794.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>In contrast to the other investigated polymorphisms, the non-synonymously coding SNP <it>MICA</it>-250 (rs1051794, Lys196Glu) was strongly associated in the first family cohort (TDT: <it>P </it>= 0.014; regression model: odds ratio [OR] 0.46, 95% confidence interval [CI] 0.25 to 0.82, <it>P </it>= 0.007). Although the replication family sample showed only a trend, combined family data remained consistent with the hypothesis of <it>MICA</it>-250 association independent from shared epitope (SE) alleles (TDT: <it>P </it>= 0.027; regression model: OR 0.56, 95% CI 0.38 to 0.83, <it>P </it>= 0.003). We also replicated the protective association of <it>MICA</it>-250A within a German Caucasian cohort (OR 0.31, 95% CI 0.1 to 0.7, <it>P </it>= 0.005; regression model: OR 0.6, 95% CI 0.37 to 0.96, <it>P </it>= 0.032). We showed complete linkage disequilibrium of <it>MICA</it>-250 (D' = 1, <it>r</it><it><sup>2</sup></it><sup/>= 1) with the functional <it>MICA </it>variant rs1051792 (D' = 1, <it>r</it><it><sup>2</sup></it><sup/>= 1). As rs1051792 confers differential allelic affinity of MICA to the receptor NKG2D, this provides a possible functional explanation for the observed association.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>We present evidence for linkage and association of <it>MICA</it>-250 (rs1051794) with RA independent of known <it>HLA-DRB1 </it>risk alleles, suggesting <it>MICA </it>as an RA susceptibility gene. However, more studies within other populations are necessary to prove the general relevance of this polymorphism for RA.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>Rheumatoid arthritis (RA) is a common autoimmune disease characterized by chronic inflammatory changes of joints and inner organs. It is estimated that at least 50% of the risk to develop RA is determined by genetic factors <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Considerable efforts have been made to elucidate these genetic factors to better understand the disease. However, even after the advent of genome-wide association studies, only somewhat more than half of the estimated genetic risk for RA has been assigned to specific genetic determinants <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. There is strong evidence <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. that additional genetic risk factors reside within a genomic region containing the strongest known genetic determinants of RA susceptibility, alleles of the <it>HLA-DRB1 </it>gene. Identification of additional risk factors within the <it>HLA-DRB1 </it>gene region is complicated by the extraordinarily high local linkage disequilibrium (LD): Standard association analyses of genetic variants in candidate gene and genome-wide association studies are prone to confounding due to LD with <it>HLA-DRB1 </it>alleles. Successful identification of additional genetic risk factors in this region needs to account for risk conferred by different <it>HLA-DRB1 </it>alleles. Within the shared epitope (SE) hypothesis, <it>HLA-DRB1 </it>alleles *0101, *0102, *0401, *0404, *0405, *0408, and *1001 are most commonly reported to be associated with risk for RA in European Caucasians <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Recently, a new classification of <it>HLA-DRB1 </it>alleles was proposed by du Montcel and colleagues <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, taking into account risk-modifying effects of neighboring amino acids. This classification emerged as especially reproducible and reliable <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>.</p>
         <p><it>MICA </it>is located within the same genomic region as <it>HLA-DRB1 </it>(Figure <figr fid="F1">1</figr>). It encodes the protein major histocompatibility complex class I polypeptide-related sequence A. This protein interacts with the C-type lectin activatory receptor NKG2D (also known as KLRK1) found on natural killer cells, &#947;&#948; T cells, and certain subgroups of &#945;&#946; T cells. MICA-NKG2D interaction is believed to be important for eliminating infected or tumorous cells <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. This interaction is also described to increase inflammatory cytokine production and proliferation of a certain subset of T cells. In consequence, implications in autoimmunity have been discussed <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. MICA is expressed in RA synovium but not in osteoarthritis synovium <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Local NKG2D expression is induced by tumor necrosis factor and interleukin-15 <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. These findings make <it>MICA </it>an interesting candidate gene for association studies in RA.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Location of <it>MICA </it>relative to the <it>HLA-DRB1 </it>locus</p>
            </caption>
            <text>
               <p>Location of <it>MICA </it>relative to the <it>HLA-DRB1 </it>locus. Despite a distance of more than one megabase from the rheumatoid arthritis risk factor <it>HLA-DRB1 </it>in the major histocompatibility complex (MHC) class II region, there is considerable linkage disequilibrium between markers in both genes. Therefore, <it>HLA-DRB1 </it>status must be considered for interpretation of genetic association data.</p>
            </text>
            <graphic file="ar2683-1"/>
         </fig>
         <p>The highly polymorphic gene <it>MICA </it>(122 frequency-validated single-nucleotide polymorphisms [SNPs] in SNP database [dbSNP] build 129) was investigated in various RA association studies in different populations. For several SNPs and for a microsatellite marker, associations with protection or risk were shown <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. Results for different <it>MICA </it>variants were not conclusive but point toward association with RA. Heterogeneity between results of these studies may be due at least partially to confounding of results by LD with <it>HLA-DRB1 </it>alleles.</p>
         <p>Some studies reported association analyses without controlling for LD of <it>MICA </it>with <it>HLA-DRB1 </it>alleles at all <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B17">17</abbr></abbrgrp>. This makes a conclusion about an independent association of <it>MICA </it>intricate. If association analysis is done under the condition of no significant LD between <it>MICA </it>and <it>HLA-DRB1 </it>alleles <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, the problem prevails: Even weak, non-significant LD may bias <it>MICA </it>association analysis since effect sizes of known <it>HLA-DRB1 </it>risk alleles are considerably large. Other authors restricted analysis to the patient subgroup without <it>HLA-DRB1 </it>risk alleles, ignoring large parts of the data <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Alternatively, stratification of data in SE and non-SE subgroups ignores variance of the individual risk of SE alleles within the SE subgroup <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. In a recent study, case-control pairs were matched 1:1 by <it>HLA-DRB1 </it>genotype to control confounding <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. However, as a disadvantage of this method, large proportions of typical RA patient and control collections are excluded from analysis since certain <it>HLA-DRB1 </it>genotypes are common in patients but rare in controls and vice versa.</p>
         <p>Our aim was to investigate the role of DNA polymorphisms of <it>MICA </it>in French Caucasian RA family trios and in a German Caucasian case-control cohort. Confounding by <it>HLA-DRB1 </it>risk alleles was controlled by analysis of the subgroup negative for known <it>HLA-DRB1 </it>risk alleles and by logistic regression including all data.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>Patients</p>
            </st>
            <p>We analyzed 600 French Caucasian individuals belonging to 200 families grouped in two cohorts of 100 family trios. Characteristics (gender, age at onset, disease duration, erosions, seropositivity, and SE) as well as details on DNA preparation were described previously <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Seventy-six percent of French RA index patients were positive for anti-cyclic citrullinated peptide antibodies (CCP<sup>+</sup>). For case-control analysis, 272 German Caucasians were analyzed. Controls were 182 healthy blood donors (mean age &#177; standard deviation [SD] was 50 &#177; 7 years, and 80% were female) from the Institute of Transfusion Medicine, University Hospital Leipzig, Germany, and cases were 90 RA patients from the Medical Clinic IV, University Hospital Leipzig, Germany, with the following characteristics: mean age (&#177; SD) at disease onset was 47.1 &#177; 15.7 years, mean (&#177; SD) disease duration was 26.7 &#177; 20.5 years, 92% were RA patients seropositive for rheumatoid factor, and 78% were female. All individuals provided informed consent, and the ethics committees of H&#244;pital Bic&#234;tre (Kremlin-Bic&#234;tre, AP-HP, France) and of the University of Leipzig (Leipzig, Germany) approved the study.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping</p>
            </st>
            <p>We investigated three polymorphisms spanning <it>MICA </it>for association with RA. For SNP selection, we required frequency validation, a map weight of 1, and a minor allele frequency exceeding 5% in Caucasians. Among 775 SNPs available within the MICA region in Ensemble version 24, 7 were frequency-validated and had a map weight of 1. Within the promoter region, defined as within 5 kb upstream of the start of the gene, we selected <it>MICA</it>-300 (rs3763288). According to TESS (Transcription Element Search System) <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, <it>MICA</it>-300 co-localizes with a binding site for the transcription factor ETV4. Within the coding region, we selected the non-synonymously coding SNP <it>MICA</it>-250 (rs1051794, Lys196Glu) as validation information for this variant was previously published <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. In addition, variant <it>MICA</it>-210 (a trinucleotide repeat (GCT)n microsatellite polymorphism within the transmembrane domain) was selected as various associations of this variant with RA were reported previously <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B22">22</abbr></abbrgrp>.</p>
            <p>Genotyping was done by applying single-base extension followed by mass spectrometry ('GenoSNIP') as described <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> but with the following modifications: polymerase chain reaction (PCR) and genotyping primers for <it>MICA</it>-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, and bioCCATGTTTCTGCTG(L)TGCTGCT; <it>MICA</it>-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and <it>MICA</it>-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, and bioCTCAGGAC(L)ACGCCGGATT. For the <it>MICA</it>-250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue sequence variant of <it>MICA </it>and <it>MICB</it>, was genotyped in 558 (63.8%) samples. This assay always indicated amplification of <it>MICA </it>and never of <it>MICB</it>. PCR products were checked by agarose gel electrophoresis for correct size and sufficient yield. Within the studied population, no Mendel error occurred. No significant departure (<it>P </it>&#8804; 0.05) from Hardy-Weinberg equilibrium was observed in controls (French samples: <it>P </it>= 0.240 for non-transmitted chromosomes; German controls: <it>P </it>= 0.233; chi-square test with one degree of freedom).</p>
            <p><it>HLA-DRB1 </it>was genotyped previously using sequence-specific PCR primers and hybridization of PCR products with probes specific for <it>HLA-DRB1 </it>alleles, as described for the French family sample <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> and the German case-control sample <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Distribution of <it>HLA-DRB1 </it>alleles can be found in the online supplement (Additional data file <supplr sid="S1">1</supplr>).</p>
            <suppl id="S1">
               <title>
                  <p>Additional data file 1</p>
               </title>
               <text>
                  <p>A table listing the distribution of <it>HLA-DRB1 </it>alleles in the analyzed RA cohorts.</p>
               </text>
               <file name="ar2683-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>For association analysis, we chose a multistep approach. In a first cohort of 100 family trios, selected polymorphisms were tested for association with RA. Those showing nominal association at a significance level of 0.05 or below were tested in a second cohort of 100 French family trios. A decrease in <it>P </it>value in the combined French cohorts was taken as strong evidence in favor of association. These polymorphisms were further analyzed in a German Caucasian case-control cohort.</p>
            <p>Haplotypes were estimated using the software HAPLORE (HAPLOtype REconstruction) <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. For these estimations, data of SNPs located between <it>MICA </it>and <it>HLA-DRB1 </it>were included (rs1800629, rs909253, rs3093553, and rs3093562 for the second French cohort and additionally rs1043618, rs2075800, rs1799964, rs1800630, rs3093662, and rs3093664 for the first French cohort; data available online <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>). We successfully assigned haplotypes for 95% of all families (minimum posterior probability was 90% and mean posterior probability was greater than 99.9%).</p>
            <p>Transmission disequilibrium test (TDT) for association and linkage with RA was calculated as described by Spielman and colleagues <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. For subgroup analyses, the subgroup without <it>HLA-DRB1 </it>risk alleles was defined by the absence of SE alleles. This is identical with allele L according to the classification by du Montcel and colleagues <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Derived haplotype information allowed identification of transmitted and non-transmitted chromosomes.</p>
            <p>For conditional logistic regression analysis of families, LogXact (Cytel Inc., Cambridge, MA, USA) was used. Within this analysis, <it>HLA-DRB1 </it>allele classification was according to du Montcel and colleagues <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. The S3P allele consisted of alleles *0101, *0102, *0404, *0405, *0408, and *1001, and the S2 allele consisted of *0401. We applied the convention that allele L denotes alleles S1, S3D, and X as the associated risk for RA of the latter three alleles was found to be of similar magnitude <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. Of the index patients of all 200 French families, 53% and 45% contributed to allele groups S3P and S2, respectively. Twenty-one percent were homozygous for allele L. In regression analysis, we modeled the transmission probability of a haplotype toward affected children given the competitive haplotype of a parent. This method is known as conditional logistic regression. To include <it>HLA-DRB1 </it>alleles in the model, allele L was used as the reference group. To ensure independence of <it>MICA </it>association from <it>HLA-DRB1 </it>risk alleles, a likelihood ratio test (LRT) was done. Here, the likelihood of the model including <it>HLA-DRB1 </it>alleles and <it>MICA </it>was compared with a model including <it>HLA-DRB1 </it>alleles only. A significant increase of the model's likelihood that includes polymorphism <it>MICA </it>(that is, an LRT <it>P </it>value of less than 0.05) indicates an association of the <it>MICA </it>polymorphism independent of the known association of <it>HLA-DRB1 </it>alleles. Analogously, we checked for interactions between <it>MICA </it>and <it>HLA-DRB1</it>. Additional methodological remarks to this method are given in the online supplement (Additional data file <supplr sid="S2">2</supplr>).</p>
            <suppl id="S2">
               <title>
                  <p>Additional data file 2</p>
               </title>
               <text>
                  <p>Background information for the conditional logistic regression method applied for family based analysis.</p>
               </text>
               <file name="ar2683-S2.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Within the case-control cohort, haplotyping was not resolvable with the same accuracy as for the family cohorts. Hence, the logistic regression model was based on unphased data of <it>MICA</it>-250 and <it>HLA-DRB1</it>. It included all case-control individuals, accounting for <it>HLA-DRB1 </it>risk alleles. <it>HLA-DRB1 </it>classification according to du Montcel and colleagues <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> as described above was applied. Cases of the case-control cohort contributed to allele groups S3P (42%) and S2 (36%). Twenty-one percent were homozygous for allele L. Within the model, genotypes were coded (0, 1, and 2), with 2 coding for the homozygous minor allele. Thus, an additive model was implemented. LRTs were done similarly to the conditional logistic regression model described above. Multimarker LD analysis was done using the software MIDAS (Multiallelic Interallelic Disequilibrium Analysis Software) <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. For the exact Mantel-Haenszel test, the software StatsDirect was used <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. If not indicated otherwise, <it>P </it>values were not corrected for multiple testing.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Association of <it>MICA </it>with rheumatoid arthritis within the first French family cohort</p>
            </st>
            <p>We analyzed three polymorphisms within the gene <it>MICA</it>: <it>MICA</it>-300 (rs3763288) within the 5' region of the gene (promoter region), <it>MICA</it>-210 (trinucleotide repeat (GCT)n microsatellite polymorphism within the transmembrane domain), and <it>MICA</it>-250 (non-synonymously coding SNP, rs1051794, Lys196Glu).</p>
            <p>In standard analysis (TDT without accounting for linkage with <it>HLA-DRB1</it>), we found significant undertransmission of <it>MICA</it>-250A in the first French family cohort (Table <tblr tid="T1">1a</tblr>). Our first strategy to account for potential LD with <it>HLA-DRB1 </it>was to restrict analysis to parents negative for <it>HLA-DRB1 </it>risk alleles. Here, we also found protective association of <it>MICA</it>-250A and RA (Table <tblr tid="T1">1b</tblr>). In our second strategy, we controlled for LD with <it>HLA-DRB1 </it>risk alleles by conditional logistic regression. <it>MICA</it>-250A again emerged as a protective factor as haplotypes including <it>MICA</it>-250A were significantly undertransmitted to affected children. The LRT was significant, demonstrating that <it>MICA</it>-250 is associated with RA independent of known <it>HLA-DRB1 </it>risk alleles (Table <tblr tid="T1">1c</tblr>).</p>
            <tbl id="T1" hint_layout="double">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Association of <it>MICA </it>polymorphisms within the first French Caucasian family cohort</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p><it>MICA</it>-210</p>
                     </c>
                     <c ca="center">
                        <p><it>MICA</it>-250</p>
                     </c>
                     <c ca="center">
                        <p><it>MICA</it>-300</p>
                     </c>
                  </r>
                  <r>
                     <c/>
                     <c cspan="5">
                        <hr/>
                     </c>
                     <c cspan="1">
                        <hr/>
                     </c>
                     <c cspan="1">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(a) French population 1 &#8211; all individuals without controlling for LD with <it>HLA-DRB1</it></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>5.1</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Frequency in cases/controls<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>7%/12%</p>
                     </c>
                     <c ca="center">
                        <p>12%/7%</p>
                     </c>
                     <c ca="center">
                        <p>42%/36%</p>
                     </c>
                     <c ca="center">
                        <p>26%/25%</p>
                     </c>
                     <c ca="center">
                        <p>13%/20%</p>
                     </c>
                     <c ca="center">
                        <p>23%/34%</p>
                     </c>
                     <c ca="center">
                        <p>8%/4%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele transmitted/untransmitted</p>
                     </c>
                     <c ca="center">
                        <p>13/21</p>
                     </c>
                     <c ca="center">
                        <p>21/13</p>
                     </c>
                     <c ca="center">
                        <p>44/36</p>
                     </c>
                     <c ca="center">
                        <p>35/33</p>
                     </c>
                     <c ca="center">
                        <p>17/29</p>
                     </c>
                     <c ca="center">
                        <p>26/48</p>
                     </c>
                     <c ca="center">
                        <p>15/7</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Transmission rate</p>
                     </c>
                     <c ca="center">
                        <p>38%</p>
                     </c>
                     <c ca="center">
                        <p>62%</p>
                     </c>
                     <c ca="center">
                        <p>55%</p>
                     </c>
                     <c ca="center">
                        <p>51%</p>
                     </c>
                     <c ca="center">
                        <p>37%</p>
                     </c>
                     <c ca="center">
                        <p>35%</p>
                     </c>
                     <c ca="center">
                        <p>68%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>TDT <it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.172</p>
                     </c>
                     <c ca="center">
                        <p>0.172</p>
                     </c>
                     <c ca="center">
                        <p>0.376</p>
                     </c>
                     <c ca="center">
                        <p>0.815</p>
                     </c>
                     <c ca="center">
                        <p>0.080</p>
                     </c>
                     <c ca="center">
                        <p>0.011</p>
                     </c>
                     <c ca="center">
                        <p>0.091</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(b) French population 1, subgroup without <it>HLA-DRB1 </it>risk alleles</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele transmitted/untransmitted</p>
                     </c>
                     <c ca="center">
                        <p>5/10</p>
                     </c>
                     <c ca="center">
                        <p>5/4</p>
                     </c>
                     <c ca="center">
                        <p>18/15</p>
                     </c>
                     <c ca="center">
                        <p>18/12</p>
                     </c>
                     <c ca="center">
                        <p>5/10</p>
                     </c>
                     <c ca="center">
                        <p>6/18</p>
                     </c>
                     <c ca="center">
                        <p>3/1</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Transmission rate</p>
                     </c>
                     <c ca="center">
                        <p>33%</p>
                     </c>
                     <c ca="center">
                        <p>56%</p>
                     </c>
                     <c ca="center">
                        <p>55%</p>
                     </c>
                     <c ca="center">
                        <p>60%</p>
                     </c>
                     <c ca="center">
                        <p>33%</p>
                     </c>
                     <c ca="center">
                        <p>25%</p>
                     </c>
                     <c ca="center">
                        <p>75%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>TDT <it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.200</p>
                     </c>
                     <c ca="center">
                        <p>0.740</p>
                     </c>
                     <c ca="center">
                        <p>0.600</p>
                     </c>
                     <c ca="center">
                        <p>0.270</p>
                     </c>
                     <c ca="center">
                        <p>0.200</p>
                     </c>
                     <c ca="center">
                        <p>0.014</p>
                     </c>
                     <c ca="center">
                        <p>0.317</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(c) French population 1, all individuals, controlling for LD with <it>HLA-DRB1 </it>by conditional logistic regression</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>OR (95% CI)<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.59</p>
                        <p>(0.25&#8211;1.34)</p>
                     </c>
                     <c ca="center">
                        <p>1.48</p>
                        <p>(0.64&#8211;3.54)</p>
                     </c>
                     <c ca="center">
                        <p>1.28</p>
                        <p>(0.77&#8211;2.16)</p>
                     </c>
                     <c ca="center">
                        <p>1.23</p>
                        <p>(0.71&#8211;2.17)</p>
                     </c>
                     <c ca="center">
                        <p>0.51</p>
                        <p>(0.24&#8211;1.05)</p>
                     </c>
                     <c ca="center">
                        <p>0.46</p>
                        <p>(0.25&#8211;0.82)</p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                        <p>(0.37&#8211;4.15)</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.235</p>
                     </c>
                     <c ca="center">
                        <p>0.428</p>
                     </c>
                     <c ca="center">
                        <p>0.379</p>
                     </c>
                     <c ca="center">
                        <p>0.518</p>
                     </c>
                     <c ca="center">
                        <p>0.072</p>
                     </c>
                     <c ca="center">
                        <p>0.007<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.944</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>LRT<sup>c </sup><it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.165</p>
                     </c>
                     <c ca="center">
                        <p>0.319</p>
                     </c>
                     <c ca="center">
                        <p>0.314</p>
                     </c>
                     <c ca="center">
                        <p>0.433</p>
                     </c>
                     <c ca="center">
                        <p>0.048</p>
                     </c>
                     <c ca="center">
                        <p>0.005<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.728</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Controls are non-transmitted alleles; <sup>b</sup>odds ratio of transmission of minor allele versus transmission of major allele as determined in logistic regression; <sup>c</sup>likelihood ratio test evaluating model including <it>HLA-DRB1 </it>alleles S2 and S3P and <it>MICA</it>-250 versus S2 and S3P only. For the <it>HLA-DRB1 </it>locus, allele L was used as reference. <sup>d</sup><it>P </it>value corrected for multiple testing less than 0.05. CI, confidence interval; LD, linkage disequilibrium; TDT, transmission disequilibrium test.</p>
               </tblfn>
            </tbl>
            <p>Association of <it>MICA</it>-250 with RA was stronger compared with association of other analyzed single markers (Table <tblr tid="T1">1</tblr>) and with three-marker haplotypes consisting of <it>MICA</it>-300, <it>MICA</it>-250, and <it>MICA</it>-210 (data not shown). Therefore, only <it>MICA</it>-250 was included in further validation studies within a second independent French Caucasian family cohort and a case-control cohort of German Caucasian origin.</p>
         </sec>
         <sec>
            <st>
               <p>Association analysis within the second and combined first and second French family cohorts</p>
            </st>
            <p>Within the second French family cohort, we found the same trend for protective association of <it>MICA</it>-250A with RA in standard analysis and in both the <it>HLA-DRB1 </it>risk allele-negative subgroup analysis and conditional logistic regression (Table <tblr tid="T2">2</tblr>). In combined analysis of both French family cohorts, association of <it>MICA</it>-250 was comparable with the association in the first French family cohort in standard analysis and in analysis of the subgroup negative for <it>HLA-DRB1 </it>risk alleles. In conditional logistic regression analysis, association in the combined cohorts was even more significant than in the first cohort alone (Tables <tblr tid="T1">1c</tblr> and <tblr tid="T2">2c</tblr>). Additionally, conditional logistic regression was done with a model in which S3P alleles were differentiated into three groups as described <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, accounting for potential differences in risk of these three groups for RA. Within this analysis, 79, 56, and 15 individuals contributed to the S3P*01, S3P*04, and S3P*10 alleles, respectively. This analysis gave similar results (data not shown). Interactions between <it>MICA</it>-250 and <it>HLA-DRB1 </it>alleles were not significant (data not shown). Full details of the regression model are shown in the online supplement (Additional data file <supplr sid="S3">3</supplr>). When the analysis of the combined first and second French cohorts was restricted to CCP<sup>+ </sup>RA, the protective association with <it>MICA</it>-250 A was also found (odds ratio [OR] 0.53, 95% confidence interval [CI] 0.33 to 0.83, <it>P </it>= 0.005; LRT <it>P </it>value = 0.003).</p>
            <suppl id="S3">
               <title>
                  <p>Additional data file 3</p>
               </title>
               <text>
                  <p>A table providing detailed results of conditional logistic regression models of all French families.</p>
               </text>
               <file name="ar2683-S3.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T2" hint_layout="double">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Association of <it>MICA </it>polymorphism within the second and combined first and second French Caucasian family cohort</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2nd French family cohort</p>
                     </c>
                     <c ca="center">
                        <p>1st + 2nd French family cohort</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(a) All individuals without controlling for LD with <it>HLA-DRB1</it></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Frequency in cases/controls<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>27%/32%</p>
                     </c>
                     <c ca="center">
                        <p>25%/33%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele transmitted/untransmitted</p>
                     </c>
                     <c ca="center">
                        <p>37/46</p>
                     </c>
                     <c ca="center">
                        <p>63/94</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Transmission rate</p>
                     </c>
                     <c ca="center">
                        <p>45%</p>
                     </c>
                     <c ca="center">
                        <p>40%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>TDT <it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.328</p>
                     </c>
                     <c ca="center">
                        <p>0.015</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(b) Subgroup without <it>HLA-DRB1 </it>risk alleles</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor allele transmitted/untransmitted</p>
                     </c>
                     <c ca="center">
                        <p>12/16</p>
                     </c>
                     <c ca="center">
                        <p>18/34</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Transmission rate</p>
                     </c>
                     <c ca="center">
                        <p>43%</p>
                     </c>
                     <c ca="center">
                        <p>35%</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>TDT <it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.450</p>
                     </c>
                     <c ca="center">
                        <p>0.027</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>(c) All individuals, controlling for LD with <it>HLA-DRB1 </it>by conditional logistic regression</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>OR (95% CI)<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.68 (0.4&#8211;1.15)</p>
                     </c>
                     <c ca="center">
                        <p>0.56 (0.38&#8211;0.83)</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.158</p>
                     </c>
                     <c ca="center">
                        <p>0.003</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>LRT<sup>c </sup><it>P </it>value</p>
                     </c>
                     <c ca="center">
                        <p>0.122</p>
                     </c>
                     <c ca="center">
                        <p>0.002</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Controls are non-transmitted alleles; <sup>b</sup>odds ratio of transmission of minor allele versus transmission of major allele as determined in logistic regression; <sup>c</sup>likelihood ratio test evaluating model including <it>HLA-DRB1 </it>alleles S2 and S3P and <it>MICA</it>-250 versus S2 and S3P only. For the <it>HLA-DRB1 </it>locus, allele L was used as reference. Effects of S2 and S3P alleles are presented in the online supplement (Additional data file <supplr sid="S3">3</supplr>). CI, confidence interval; LD, linkage disequilibrium; TDT, transmission disequilibrium test.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Association analysis within the case-control cohort</p>
            </st>
            <p>After demonstrating association of <it>MICA </it>with RA in French Caucasian family trios and its independence from HLA risk alleles, we analyzed the effect of <it>MICA </it>within a German Caucasian case-control cohort. Frequencies of <it>MICA</it>-250A were similar within the German and French populations (33% in controls). Again, we found protective association of <it>MICA</it>-250A with RA in standard analysis and within the subgroup of the case-control cohort not carrying SE alleles (Tables <tblr tid="T3">3a</tblr> and <tblr tid="T3">3b</tblr>). Logistic regression including all individuals demonstrated a significant protective effect as well. Significance in the LRT showed that this association was independent of <it>HLA-DRB1 </it>risk alleles (Table <tblr tid="T3">3c</tblr>). Details of the regression model are given in the online supplement (Additional data file <supplr sid="S4">4</supplr>). Additionally, conditional logistic regression was done with a model in which S3P alleles were differentiated into three groups (S3P*01, S3P*04, and S3P*10) as described <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, accounting for potential differences of these three groups in risk for RA. This analysis resulted in similar results (data not shown).</p>
            <suppl id="S4">
               <title>
                  <p>Additional data file 4</p>
               </title>
               <text>
                  <p>A table providing detailed results of logistic regression models of the German case control cohort.</p>
               </text>
               <file name="ar2683-S4.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Analysis of linkage disequilibrium</p>
            </st>
            <p>LD was analyzed within parents of the family cohorts and in the case-control cohort. As the German cohort was smaller, power to detect LD was decreased compared with power to detect LD within the French cohorts. Significant LD was found between <it>HLA-DRB1</it>-S3P and <it>MICA</it>-250A within parents of the French family cohorts (D' = +0.21, <it>P </it>&lt; 0.001). Interestingly, this LD was positive between <it>HLA-DRB1 </it>risk alleles of subgroup S3P and the protective allele <it>MICA</it>-250A. In-depth analysis of the S3P group revealed that this resulted mainly from LD between <it>HLA-DRB1</it>*01 and <it>MICA</it>-250A, which was significant within parents of the family cohorts and cases from the case-control cohort (D' = +0.38 and +0.25 with <it>P </it>values of 2 &#215; 10<sup>-7 </sup>and 0.047, respectively). Significant negative LD was found between <it>HLA-DRB1</it>-S2 and <it>MICA</it>-250A (D' = -0.51, <it>P </it>&lt; 0.01) in French parents. No significant LD was found between <it>HLA-DRB1</it>-L within the family cohorts and individuals of the case-control cohort. In consequence, there was no significant correlation of carriage of <it>MICA</it>-250A with carriage of positive or negative SE status. LD was also analyzed between <it>MICA</it>-250 and rs1051792, another coding SNP with functional implications <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. Within a representative sample of 182 French Caucasian and 181 German Caucasian cases and controls, both polymorphisms were in perfect LD (<it>r</it><it><sup>2</sup></it><sup/>= 1, D' = 1).</p>
         </sec>
         <sec>
            <st>
               <p>Representation of association analysis in all informative families controlling for linkage disequilibrium with HLA-DRB1</p>
            </st>
            <p>An advantage of the conditional logistic regression approach is the integration of all data from all informative parents with respect to <it>HLA-DRB1 </it>and <it>MICA</it>. A single statistic reveals independent association of <it>MICA</it>-250. However, it is of interest to compare subgroup analysis of parents negative for <it>HLA-DRB1 </it>risk alleles with results of the regression model analyzing all data in detail (Tables <tblr tid="T2">2b</tblr> and <tblr tid="T2">2c</tblr>). A major difference is that the regression model additionally includes information of parents that are informative (that is, heterozygous) for <it>MICA </it>and that are also heterozygous for <it>HLA-DRB1 </it>risk alleles. How can the effect of <it>MICA</it>-250 on transmission be represented within these parents, devoid of the effect of <it>HLA-DRB1 </it>risk alleles? We propose to stratify <it>HLA-DRB1 </it>heterozygous parents according to their genotype. The transmission ratio under the null hypothesis of no association within these parents will differ from a 50/50 ratio reflecting the different risk levels of both <it>HLA-DRB1 </it>alleles. However, under the null hypothesis of no association of <it>MICA</it>-250, a two-marker haplotype consisting of <it>MICA</it>-250A and a certain <it>HLA-DRB1 </it>allele should have the same transmission rate as a two-marker haplotype consisting of <it>MICA</it>-250G and the same <it>HLA-DRB1 </it>allele. A deviation from this transmission rate represents an independent effect of <it>MICA</it>-250A quantifiable as an OR of <it>MICA</it>-250A transmission. As we applied the classification of du Montcel and colleagues <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> of <it>HLA-DRB1 </it>alleles, three different independent strata of <it>HLA-DRB1 </it>heterozygote parents exist: S3P/S2, S2/L, and S3P/L. Within all of these strata, we always found a decreased transmission of haplotypes carrying <it>MICA</it>-250A compared with the respective haplotype carrying <it>MICA</it>-250G (OR 0.33, 95% CI 0.02 to 5.11; OR 0.45, 95% CI 0.04 to 6.76; and OR 0.44, 95% CI 0.04 to 2.73, respectively, data of all families) (Additional data file <supplr sid="S5">5</supplr>). These observations are consistent with the significant protective association of <it>MICA</it>-250A revealed by conditional logistic regression (Table <tblr tid="T2">2</tblr>).</p>
            <suppl id="S5">
               <title>
                  <p>Additional data file 5</p>
               </title>
               <text>
                  <p>A table providing a representation of association analysis in all informative families controlling for LD with DRB1.</p>
               </text>
               <file name="ar2683-S5.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>When we additionally include data from parents homozygous for <it>HLA-DRB1</it>, we can analyze the OR of <it>MICA</it>-250A on transmission within these parents when we compare the observed transmission ratio of <it>MICA</it>-250A versus the expected transmission ratio (Additional data file <supplr sid="S5">5</supplr>). The expected transmission ratio is 50/50 (transmitted/non-transmitted) within these parents under the null hypothesis of no effect of <it>MICA</it>-250A. We now can combine information from all parents informative for <it>MICA</it>-250 by combining all four ORs of all four independent strata with exact Mantel-Haenszel methodology. This analysis confirmed a significant undertransmission of <it>MICA</it>-250A within all data of all families (OR 0.48, 95% CI 0.25 to 0.91, <it>P </it>= 0.02, Fisher exact test).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The aim of this study was to analyze the association of polymorphisms of <it>MICA </it>with risk for RA while controlling for the effects of <it>HLA-DRB1 </it>risk alleles. We successfully identified <it>MICA</it>-250A as a new independent marker associated with protection from RA susceptibility. We analyzed the association of three genetic variants of the gene <it>MICA </it>with susceptibility to RA in a French Caucasian family cohort. In validation studies (including an additional independent French Caucasian family cohort and a German Caucasian case-control cohort), we focused on the non-synonymously coding SNP <it>MICA</it>-250 (rs1051794, Lys196Glu). In our first French family cohort, this SNP presented with the strongest evidence for association in terms of <it>P </it>values and transmission rate (Table <tblr tid="T1">1</tblr>). Association of three-marker haplotypes of <it>MICA </it>with RA was not statistically significant. Therefore, we did not investigate haplotype association further. However, it cannot be excluded that association of <it>MICA</it>-250 with RA may be related to an unknown allelic variant in linkage with these haplotypes as haplotypes were inferred and have error margins.</p>
         <p>Within all combined French families, we found a significant undertransmission of <it>MICA</it>-250A in the TDT (Table <tblr tid="T2">2</tblr>). Therefore, we hereby provide evidence for linkage and association of <it>MICA</it>-250A with RA. This transmission analysis within trio families would not be affected by hidden population stratification. The association was also evident in conditional logistic regression analyses including all parents informative for <it>MICA</it>-250A and controlling for LD with <it>HLA-DRB1 </it>risk alleles (Table <tblr tid="T2">2c</tblr>). We did not find any indication that the observed protective effect of <it>MICA</it>-250A is especially present on the background of certain <it>HLA-DRB1 </it>alleles as interaction analyses of <it>MICA</it>-250 and <it>HLA-DRB1 </it>alleles in the regression model did not result in a significantly increased likelihood (data not shown). Additionally, detailed transmission analysis of <it>MICA</it>-250 within parents heterozygous or homozygous for <it>HLA-DRB1 </it>always resulted in a protective effect of <it>MICA</it>-250A of comparable magnitude irrespective of present <it>HLA-DRB1 </it>alleles (Additional data file <supplr sid="S5">5</supplr>). Analysis of the CCP<sup>+ </sup>subset showed that <it>MICA</it>-250 also associates with CCP<sup>+ </sup>RA. We confirmed the protective effect in a German Caucasian RA case-control cohort (Table <tblr tid="T3">3</tblr>), which indicates that the protective effect may not be restricted to the French Caucasian population alone.</p>
         <tbl id="T3" hint_layout="double">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Case-control analysis in German Caucasians</p>
            </caption>
            <tblbdy cols="2">
               <r>
                  <c ca="left">
                     <p>(a) All individuals without controlling for LD with <it>HLA-DRB1</it></p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>Minor allele</p>
                  </c>
                  <c ca="center">
                     <p>250A</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>Allele frequency in cases/controls</p>
                  </c>
                  <c ca="center">
                     <p>22%/33%</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>Total alleles of RA cases/controls</p>
                  </c>
                  <c ca="center">
                     <p>178/368</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>OR (95% CI)</p>
                  </c>
                  <c ca="center">
                     <p>0.60 (0.4&#8211;0.9)</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>OR <it>P </it>value</p>
                  </c>
                  <c ca="center">
                     <p>0.016</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>(b) Subgroup without <it>HLA-DRB1 </it>risk alleles</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>Frequency in cases/controls</p>
                  </c>
                  <c ca="center">
                     <p>14%/34%</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>Total alleles of RA cases/controls</p>
                  </c>
                  <c ca="center">
                     <p>50/216</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>OR (95% CI)</p>
                  </c>
                  <c ca="center">
                     <p>0.31 (0.1&#8211;0.7)</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>OR <it>P </it>value</p>
                  </c>
                  <c ca="center">
                     <p>0.005</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>(c) All individuals, controlling for LD with <it>HLA-DRB1 </it>by logistic regression</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>OR (95% CI)</p>
                  </c>
                  <c ca="center">
                     <p>0.6 (0.37&#8211;0.96)</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p><it>P </it>value</p>
                  </c>
                  <c ca="center">
                     <p>0.032</p>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>LRT<sup>a </sup><it>P </it>value</p>
                  </c>
                  <c ca="center">
                     <p>0.022</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>a</sup>Likelihood ratio test evaluating model including <it>HLA-DRB1 </it>alleles S2 and S3P and <it>MICA</it>-250 versus S2 and S3P only. For the <it>HLA-DRB1 </it>locus, allele L was used as reference. CI, confidence interval; LD, linkage disequilibrium; OR, odds ratio; RA, rheumatoid arthritis.</p>
            </tblfn>
         </tbl>
         <p>True association of <it>MICA</it>-250 with RA may be either feigned or masked by LD with known risk alleles. Therefore, we controlled for the separate contributions of <it>MICA</it>-250 and <it>HLA-DRB1 </it>alleles (S3P, S2, and L) to the observed effect by logistic regression. This allowed us to make use of data from all patients. However, it could be argued that this logistic regression might be affected by stratification of the individual <it>HLA-DRB1 </it>risk alleles in the groups used in the model. Hence, we also analyzed the subgroup of patients not carrying <it>HLA-DRB1 </it>risk alleles. Naturally, this subgroup does not contain data from all patients, but results are completely independent from the excluded <it>HLA-DRB1 </it>risk alleles. Both methods showed association of <it>MICA</it>-250A with RA.</p>
         <p>In this context, it is of interest that, within all genome-wide association studies of RA published thus far, <it>MICA</it>-250 was found to be nominally associated: <it>MICA</it>-250A had a protective effect (OR 0.82, 95% CI 0.73 to 0.92, <it>P </it>= 0.0008, not corrected for genome-wide testing) within CCP<sup>+ </sup>RA in North American samples <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Similar findings result from a genome-wide study in a British RA cohort, in which data for an SNP in perfect LD with <it>MICA</it>-250 are available (rs1051792: OR 0.85, 95% CI 0.77 to 0.93, <it>P </it>= 0.0008, not corrected for genome-wide testing) <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. These findings corroborate our observation of a protective effect of <it>MICA</it>-250A in CCP<sup>+ </sup>RA. <it>MICA</it>-250 was also associated with RA in a genome-wide study in a Spanish Caucasian cohort (<it>P </it>= 0.02, not corrected for genome-wide testing) <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. In these genome-wide studies, association analysis was reported without controlling for LD of <it>MICA </it>alleles with <it>HLA-DRB1 </it>alleles. If LD structure in Caucasians in these genome-wide studies was similar to that in our study (that is, if positive LD between <it>HLA-DRB1</it>*0101 and <it>MICA</it>-250A was present), LD-corrected protective association of <it>MICA</it>-250A would be even stronger than reported.</p>
         <p>The microsatellite polymorphism <it>MICA</it>-210 was studied in different populations. In Spanish <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and Canadian <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> Caucasians, a protective effect was seen for allele <it>MICA</it>-210 6.0, whereas in Korean Asians <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, a protective effect was seen for <it>MICA</it>-210 9.0. No association of <it>MICA</it>-210 was seen in another Spanish Caucasian RA study <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. None of these studies additionally analyzed <it>MICA</it>-250. However, in our study, strong LD between <it>MICA</it>-210 9.0 and <it>MICA</it>-250A was found (D' = 0.98, <it>P </it>&lt; 10<sup>-15</sup>). Therefore, previous findings in Koreans are in accordance with our results. It is of interest that in this study only a single <it>HLA-DRB1 </it>RA susceptibility allele (*0405) predominates and no LD was found with *0405 and <it>MICA</it>-210 9.0, so that association analysis was hardly influenced by linkage with known <it>HLA-DRB1 </it>risk alleles. This is different from the Caucasian studies of the (GCT)n polymorphism: In our data, we found considerable LD between various <it>MICA</it>-210 alleles and <it>HLA-DRB1 </it>risk alleles (data not shown). We might speculate that complex LD structure between <it>MICA</it>-210 alleles and <it>HLA-DRB1 </it>alleles may at least partially explain differing results in Caucasian association studies of <it>MICA</it>-210 and RA. This is especially relevant as these studies either did not account at all or only partially accounted for LD with <it>HLA-DRB1 </it>alleles.</p>
         <p>In recently published work, <it>HLA-DRB1</it>-matched cases and controls were analyzed mainly in American Caucasians in order to identify genetic factors associated with CCP<sup>+ </sup>RA in addition to known <it>HLA-DRB1 </it>risk alleles <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Within the <it>MICA </it>genomic region, significant evidence for independent association with RA was found with a maximum association within HLA-C. This association was attributed to the risk of the A1-B8-<it>DRB1</it>*03 haplotype. Additionally, haplotypes carrying <it>HLA-DRB1</it>*0404 were described to be <it>HLA-DRB1</it>-independent risk factors. An analysis of <it>MICA</it>-250 was not reported in this study. There is evidence that association of <it>MICA</it>-250A in our data represents an additional disease-modifying factor, independent of described risk factors in the American Caucasian study. This evidence results from the observation that a protective association of <it>MICA</it>-250A is still observed when all parents carrying either <it>HLA-DRB1</it>*03 or <it>HLA-DRB1</it>*0404 were excluded (OR 0.56, 95% CI 0.35 to 0.89, <it>P </it>= 0.013; LRT <it>P </it>value = 0.009).</p>
         <p>Generally, an observed association of a polymorphism with a phenotype need not arise from a direct functional effect of this polymorphism. It may simply originate from LD with a functional polymorphism. Therefore, it is of interest that the amino acid change due to <it>MICA</it>-250A (Lys196Glu) is predicted to influence Hsp70 binding <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Possibly even more relevant, SNP rs1051792, in perfect LD with <it>MICA</it>-250 in Caucasian HapMap data and in our data, was experimentally shown to influence binding of the NKG2D receptor <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. Variant rs1051792A, corresponding to <it>MICA</it>-250A, was shown to strongly bind NKG2D. All other alleles lead to weaker binding. Several studies show that NKG2D expression is modulated by MICA expression level with consequences for immune reactions. Wiemann and colleagues <abbrgrp><abbr bid="B35">35</abbr></abbrgrp> showed that persistent expression of MICA in transgenic mice resulted in downregulation of the amount of surface NKG2D. As a consequence, impaired immune reaction against bacteria and MICA-expressing tumors was observed. In a different context, Mincheva-Nilsson and colleagues <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> observed elevated levels of soluble MICA/MICB and a decreased level of NKG2D within maternal blood of healthy pregnant women. The authors showed that soluble MICA/MICB downregulates NKG2D levels and immune reactions <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Therefore, we speculate that an increased affinity of MICA to NKG2D, as must be present in carriers of <it>MICA</it>-250A, may have similar effects as increased expression of MICA, resulting in decreased NKG2D expression levels.</p>
         <p>In this context, the observation of RA remission during pregnancy may be of interest <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Apparently, decrease of NKG2D plays a central role in decreased immune response. During pregnancy, this seems to be triggered by increased levels of MICA/MICB and appears to contribute to tolerance against the fetus and disease remission in women with RA. As pregnant women show both downregulation of NKG2D due to increased MICA expression and remission of RA, it can be speculated that there may be a functional link between these two observations. If <it>MICA</it>-250A reports on stronger binding of MICA and if this also results in downregulation of NKG2D levels, this would be consistent with the observed protective effect of <it>MICA</it>-250A in our data. As there are many links between the innate and adaptive immune systems and involvement of pathogens in the initiation of RA is discussed (reviewed by Falgarone and colleagues <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>), differences in NKG2D levels induced by functional variants of MICA are not unlikely to have consequences for RA etiology.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>In summary, we present evidence for linkage and association of <it>MICA</it>-250 (rs1051794) with RA independently of known <it>HLA-DRB1 </it>association in French Caucasians and evidence for association in a German Caucasian population, suggesting <it>MICA </it>as an RA susceptibility gene. The association might be explained by functional evidence of rs1051792, an SNP in perfect LD with <it>MICA</it>-250. However, more studies within other populations are necessary to prove the general relevance of this polymorphism with RA.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CCP<sup>+</sup>: positive for anti-cyclic citrullinated peptide antibodies; CI: confidence interval; LD: linkage disequilibrium; LRT: likelihood ratio test; OR: odds ratio; PCR: polymerase chain reaction; RA: rheumatoid arthritis; SD: standard deviation; SE: shared epitope; SNP: single-nucleotide polymorphism; TDT: transmission disequilibrium test.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>HK helped to carry out the molecular genetic studies, performed acquisition of the data, helped to perform analysis and interpretation of the data, and drafted the manuscript. HH and JB helped to carry out the molecular genetic studies. MS, DHe, BP, CP, EP-T, and FC helped to perform analysis and interpretation of the data. DHa and PA helped to perform analysis and interpretation of the data and to draft the manuscript. VHT and UW (and the European Consortium on Rheumatoid Arthritis Families) contributed to the recruitment of families and to the acquisition of clinical data. FE and US helped to draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are grateful to the RA patients, their families, control individuals, and rheumatologists for participating in this study. We thank Laetitia Michou for previous work in HLA typing and classification of alleles, J&#246;rg Reichhardt for supporting statistical analysis, Knut M Wittkowski for valuable discussion, and Grit Wolfram for expert technical assistance. This project was supported by grants from the German Federal Ministry for Education and Research 'Hochschul-Wissenschafts-Programm' (to PA), the Saechsische Aufbaubank (7692/1187), the European Fund for Regional Development (EFRE 4212/04-04) (to PA), the German Federal Ministry for Education and Research (01KN0702) (to PA and MS), and the German Federal Ministry for Education and Research (0313909) (to HK). This work was also supported by Association Fran&#231;aise des Polyarthritiques, Association Rhumatisme et Travail, Association Polyarctique, Groupe Taitbout, Genopole<sup>&#174;</sup>, Universit&#233; Evry-Val d'Essonne, and the European Union (AutoCure).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Genetics of rheumatoid arthritis: is there a pattern predicting extraarticular manifestations?</p>
            </title>
            <aug>
               <au>
                  <snm>Turesson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Weyand</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Matteson</snm>
                  <fnm>EL</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>51</volume>
            <fpage>853</fpage>
            <lpage>863</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20693</pubid>
                  <pubid idtype="pmpid" link="fulltext">15478157</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Re-evaluation of putative rheumatoid arthritis susceptibility genes in the post-genome wide association study era and hypothesis of a key pathway underlying susceptibility</p>
            </title>
            <aug>
               <au>
                  <snm>Barton</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Thomson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Ke</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Eyre</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hinks</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bowes</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gibbons</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Plant</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <cnm>Wellcome Trust Case Control Consortium</cnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Marinou</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Morgan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Emery</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <cnm>YEAR consortium</cnm>
               </au>
               <au>
                  <snm>Steer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hocking</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Wordsworth</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Worthington</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2008</pubdate>
            <volume>17</volume>
            <fpage>2274</fpage>
            <lpage>2279</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2465799</pubid>
                  <pubid idtype="pmpid" link="fulltext">18434327</pubid>
                  <pubid idtype="doi">10.1093/hmg/ddn128</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Dissecting the genetic complexity of the association between human leukocyte antigens and rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Jawaheer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Damle</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Monteiro</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Khalili</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lundsten</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Begovich</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bugawan</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Erlich</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Elder</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Criswell</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Amos</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Behrens</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>PK</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2002</pubdate>
            <volume>71</volume>
            <fpage>585</fpage>
            <lpage>594</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">449696</pubid>
                  <pubid idtype="pmpid" link="fulltext">12181776</pubid>
                  <pubid idtype="doi">10.1086/342407</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Several regions in the major histocompatibility complex confer risk for anti-CCP- antibody positive rheumatoid arthritis, independent of the DRB1 locus</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Criswell</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Amos</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Carulli</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Navarrete</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Remmers</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Kastner</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Plenge</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>PK</fnm>
               </au>
            </aug>
            <source>Mol Med</source>
            <pubdate>2008</pubdate>
            <volume>14</volume>
            <fpage>293</fpage>
            <lpage>300</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2255558</pubid>
                  <pubid idtype="pmpid" link="fulltext">18309376</pubid>
                  <pubid idtype="doi">10.2119/2007-00123.Lee</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Dissection of class III major histocompatibility complex haplotypes associated with rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Newton</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Harney</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Timms</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Sims</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Rockett</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Darke</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Wordsworth</snm>
                  <fnm>BP</fnm>
               </au>
               <au>
                  <snm>Kwiatkowski</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>2122</fpage>
            <lpage>2129</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20358</pubid>
                  <pubid idtype="pmpid" link="fulltext">15248209</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Influence of shared epitope-negative HLA-DRB1 alleles on genetic susceptibility to rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Reviron</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Perdriger</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Toussirot</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wendling</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Balandraud</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Guis</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Semana</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tiberghien</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Mercier</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Roudier</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2001</pubdate>
            <volume>44</volume>
            <fpage>535</fpage>
            <lpage>540</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/1529-0131(200103)44:3&lt;535::AID-ANR101>3.0.CO;2-Z</pubid>
                  <pubid idtype="pmpid" link="fulltext">11263767</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>New classification of HLA-DRB1 alleles supports the shared epitope hypothesis of rheumatoid arthritis susceptibility</p>
            </title>
            <aug>
               <au>
                  <snm>du Montcel</snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Michou</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Petit-Teixeira</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Osorio</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lemaire</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lasbleiz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pierlot</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Quillet</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bardin</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Prum</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Cornelis</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Clerget-Darpoux</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2005</pubdate>
            <volume>52</volume>
            <fpage>1063</fpage>
            <lpage>1068</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20989</pubid>
                  <pubid idtype="pmpid" link="fulltext">15818663</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>The shared epitope hypothesis in rheumatoid arthritis: Evaluation of alternative classification criteria in a large UK Caucasian cohort</p>
            </title>
            <aug>
               <au>
                  <snm>Morgan</snm>
                  <fnm>AW</fnm>
               </au>
               <au>
                  <snm>Haroon-Rashid</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>SG</fnm>
               </au>
               <au>
                  <snm>Gooi</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Worthington</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Thomson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Barrett</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Emery</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2008</pubdate>
            <volume>58</volume>
            <fpage>1275</fpage>
            <lpage>1283</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.23432</pubid>
                  <pubid idtype="pmpid" link="fulltext">18438843</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p><it>In vivo </it>expression pattern of MICA and MICB and its relevance to auto-immunity and cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Schrambach</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ardizzone</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Leymarie</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sibilia</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bahram</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>PLoS ONE</source>
            <pubdate>2007</pubdate>
            <volume>2</volume>
            <fpage>e518</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1885219</pubid>
                  <pubid idtype="pmpid" link="fulltext">17565371</pubid>
                  <pubid idtype="doi">10.1371/journal.pone.0000518</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>MICA response to gliadin in intestinal mucosa from celiac patients</p>
            </title>
            <aug>
               <au>
                  <snm>Martin-Pagola</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Perez-Nanclares</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ortiz</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Vitoria</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Hualde</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Zaballa</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Preciado</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Castano</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bilbao</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Immunogenetics</source>
            <pubdate>2004</pubdate>
            <volume>56</volume>
            <fpage>549</fpage>
            <lpage>554</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00251-004-0724-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">15490153</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Expansion of circulating NKG2D<sup>+ </sup>effector memory T-cells and expression of NKG2D-ligand MIC in granulomaous lesions in Wegener's granulomatosis</p>
            </title>
            <aug>
               <au>
                  <snm>Capraru</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>M&#252;ller</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Csernok</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gross</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Holl-Ulrich</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Northfield</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Klenerman</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Herlyn</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Holle</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gottschlich</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Voswinkel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Spies</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fagin</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Jabs</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Lamprecht</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Clin Immunol</source>
            <pubdate>2008</pubdate>
            <volume>127</volume>
            <fpage>144</fpage>
            <lpage>150</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.clim.2007.12.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">18313361</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Stimulation of T cell autoreactivity by anomalous expression of NKG2D and its MIC ligands in rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Groh</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Bruhl</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>El Gabalawy</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Spies</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2003</pubdate>
            <volume>100</volume>
            <fpage>9452</fpage>
            <lpage>9457</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">170939</pubid>
                  <pubid idtype="pmpid" link="fulltext">12878725</pubid>
                  <pubid idtype="doi">10.1073/pnas.1632807100</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Analysis of single-nucleotide polymorphisms in Japanese rheumatoid arthritis patients shows additional susceptibility markers besides the classic shared epitope susceptibility sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Kochi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamada</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takahashi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sekine</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mabuchi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Akiyama</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Tsunoda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>63</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.11366</pubid>
                  <pubid idtype="pmpid" link="fulltext">14730600</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>MHC class I chain-related gene B (MICB) is associated with rheumatoid arthritis susceptibility</p>
            </title>
            <aug>
               <au>
                  <snm>L&#243;pez-Arbesu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ballina-Garc&#237;a</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Alperi-L&#243;pez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>L&#243;pez-Soto</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rodr&#237;guez-Rodero</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mart&#237;nez-Borra</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>L&#243;pez-V&#225;zquez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fern&#225;ndez-Morera</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Riestra-Noriega</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Queiro-Silva</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Qui&#241;ones-Lombra&#241;a</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>L&#243;pez-Larrea</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gonz&#225;lez</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Rheumatology (Oxford)</source>
            <pubdate>2007</pubdate>
            <volume>46</volume>
            <fpage>426</fpage>
            <lpage>430</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/rheumatology/kel331</pubid>
                  <pubid idtype="pmpid" link="fulltext">17003176</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Primary association of a MICA allele with protection against rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Martinez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fernandez-Arquero</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Balsa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rubio</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Alves</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pascual-Salcedo</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Martin-Mola</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>de la Concha</snm>
                  <fnm>EG</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2001</pubdate>
            <volume>44</volume>
            <fpage>1261</fpage>
            <lpage>1265</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/1529-0131(200106)44:6&lt;1261::AID-ART217>3.0.CO;2-L</pubid>
                  <pubid idtype="pmpid" link="fulltext">11407684</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Association of MICA polymorphism with rheumatoid arthritis patients in Koreans</p>
            </title>
            <aug>
               <au>
                  <snm>Mok</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>EB</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>YW</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>Hum Immunol</source>
            <pubdate>2003</pubdate>
            <volume>64</volume>
            <fpage>1190</fpage>
            <lpage>1194</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.humimm.2003.09.010</pubid>
                  <pubid idtype="pmpid" link="fulltext">14630402</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Microsatellite polymorphism of the MICA gene and susceptibility to rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Singal</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Clin Exp Rheumatol</source>
            <pubdate>2001</pubdate>
            <volume>19</volume>
            <fpage>451</fpage>
            <lpage>452</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11491503</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22&#8211;620W allele</p>
            </title>
            <aug>
               <au>
                  <snm>Dieude</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Garnier</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Michou</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Petit-Teixeira</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Glikmans</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Pierlot</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lasbleiz</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bardin</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Prum</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Cornelis</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <fpage>R1200</fpage>
            <lpage>R1207</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1297567</pubid>
                  <pubid idtype="pmpid" link="fulltext">16277672</pubid>
                  <pubid idtype="doi">10.1186/ar1812</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Using TESS to predict transcription factor binding sites in DNA sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Schug</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Curr Protoc Bioinformatics</source>
            <pubdate>2008</pubdate>
            <volume>Chapter 2</volume>
            <issue>Unit 2.6</issue>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18428685</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Allelic repertoire of the human MHC class I MICA gene</p>
            </title>
            <aug>
               <au>
                  <snm>Fodil</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Laloux</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wanner</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Pellet</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hauptmann</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Mizuki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Inoko</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Spies</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Theodorou</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bahram</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Immunogenetics</source>
            <pubdate>1996</pubdate>
            <volume>44</volume>
            <fpage>351</fpage>
            <lpage>357</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02602779</pubid>
                  <pubid idtype="pmpid">8781120</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Frequency and distribution in three ethnic populations of single nucleotide polymorphisms in the MICA gene</p>
            </title>
            <aug>
               <au>
                  <snm>Powell</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Shi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Drummond</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>EJ</fnm>
               </au>
            </aug>
            <source>Mutat Res</source>
            <pubdate>2001</pubdate>
            <volume>432</volume>
            <fpage>47</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11465541</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Triplet repeat polymorphism in the transmembrane region of the MICA gene: a strong association of six GCT repetitions with Behcet disease</p>
            </title>
            <aug>
               <au>
                  <snm>Mizuki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ota</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kimura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ando</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Katsuyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bahram</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Inoko</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>1298</fpage>
            <lpage>1303</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">19785</pubid>
                  <pubid idtype="pmpid" link="fulltext">9037047</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.4.1298</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Robustness of single-base extension against mismatches at the site of primer attachment in a clinical assay</p>
            </title>
            <aug>
               <au>
                  <snm>Kirsten</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Teupser</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Weissfuss</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wolfram</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Emmrich</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ahnert</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>J Mol Med</source>
            <pubdate>2007</pubdate>
            <volume>85</volume>
            <fpage>361</fpage>
            <lpage>369</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00109-006-0129-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">17160404</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients</p>
            </title>
            <aug>
               <au>
                  <snm>Pierer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kaltenhauser</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Arnold</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wahle</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baerwald</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hantzschel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <fpage>R75</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1526616</pubid>
                  <pubid idtype="pmpid" link="fulltext">16635271</pubid>
                  <pubid idtype="doi">10.1186/ar1945</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>HAPLORE: a program for haplotype reconstruction in general pedigrees without recombination</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <fpage>90</fpage>
            <lpage>103</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bth388</pubid>
                  <pubid idtype="pmpid" link="fulltext">15231536</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>GenHotel &#8211; EA3886 Laboratoire de Recherche Europ&#233;en pour la Polyarthrite Rhumato&#239;de</p>
            </title>
            <url>http://www.polyarthrite.info</url>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM)</p>
            </title>
            <aug>
               <au>
                  <snm>Spielman</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>McGinnis</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Ewens</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1993</pubdate>
            <volume>52</volume>
            <fpage>506</fpage>
            <lpage>516</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1682161</pubid>
                  <pubid idtype="pmpid">8447318</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>MIDAS: software for analysis and visualisation of interallelic disequilibrium between multiallelic markers</p>
            </title>
            <aug>
               <au>
                  <snm>Gaunt</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Rodriguez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zapata</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Day</snm>
                  <fnm>IN</fnm>
               </au>
            </aug>
            <source>BMC Bioinformatics</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <fpage>227</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1479374</pubid>
                  <pubid idtype="pmpid" link="fulltext">16643648</pubid>
                  <pubid idtype="doi">10.1186/1471-2105-7-227</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>StatsDirect Statistical Software</p>
            </title>
            <url>http://www.statsdirect.com</url>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Interactions of human NKG2D with its ligands MICA, MICB, and homologs of the mouse RAE-1 protein family</p>
            </title>
            <aug>
               <au>
                  <snm>Steinle</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Groh</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Lanier</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Strong</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Spies</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Immunogenetics</source>
            <pubdate>2001</pubdate>
            <volume>53</volume>
            <fpage>279</fpage>
            <lpage>287</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s002510100325</pubid>
                  <pubid idtype="pmpid">11491531</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>TRAF1-C5 as a risk locus for rheumatoid arthritis &#8211; a genomewide study</p>
            </title>
            <aug>
               <au>
                  <snm>Plenge</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Seielstad</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Padyukov</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Remmers</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Ding</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Liew</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Khalili</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Chandrasekaran</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>LR</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Tan</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Bonnard</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ong</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Thalamuthu</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pettersson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tian</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>WV</fnm>
               </au>
               <au>
                  <snm>Carulli</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Beckman</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Altshuler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Alfredsson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Criswell</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Amos</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Kastner</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Klareskog</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>PK</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>2007</pubdate>
            <volume>357</volume>
            <fpage>1199</fpage>
            <lpage>1209</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2636867</pubid>
                  <pubid idtype="pmpid" link="fulltext">17804836</pubid>
                  <pubid idtype="doi">10.1056/NEJMoa073491</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls</p>
            </title>
            <aug>
               <au>
                  <cnm>Wellcome Trust Case Control Consortium</cnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2007</pubdate>
            <volume>447</volume>
            <fpage>661</fpage>
            <lpage>678</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature05911</pubid>
                  <pubid idtype="pmpid" link="fulltext">17554300</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Genome-wide association study of rheumatoid arthritis in the Spanish population: KLF12 as a risk locus for rheumatoid arthritis susceptibility</p>
            </title>
            <aug>
               <au>
                  <snm>Juli&#224;</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ballina</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ca&#241;ete</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Balsa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tornero-Molina</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Naranjo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Alperi-L&#243;pez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Erra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pascual-Salcedo</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Barcel&#243;</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Camps</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Marsal</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2008</pubdate>
            <volume>58</volume>
            <fpage>2275</fpage>
            <lpage>2286</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.23623</pubid>
                  <pubid idtype="pmpid" link="fulltext">18668548</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>SNPeffect v2.0: a new step in investigating the molecular phenotypic effects of human non-synonymous SNPs</p>
            </title>
            <aug>
               <au>
                  <snm>Reumers</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Maurer-Stroh</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schymkowitz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rousseau</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2006</pubdate>
            <volume>22</volume>
            <fpage>2183</fpage>
            <lpage>2185</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btl348</pubid>
                  <pubid idtype="pmpid" link="fulltext">16809394</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Systemic NKG2D down-regulation impairs NK and CD8 T cell responses <it>in vivo</it></p>
            </title>
            <aug>
               <au>
                  <snm>Wiemann</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Mittrucker</snm>
                  <fnm>HW</fnm>
               </au>
               <au>
                  <snm>Feger</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Welte</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Yokoyama</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Spies</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Rammensee</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Steinle</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>175</volume>
            <fpage>720</fpage>
            <lpage>729</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16002667</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Placenta-derived soluble MHC class I chain-related molecules down-regulate NKG2D receptor on peripheral blood mononuclear cells during human pregnancy: a possible novel immune escape mechanism for fetal survival</p>
            </title>
            <aug>
               <au>
                  <snm>Mincheva-Nilsson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nagaeva</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Stendahl</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Antsiferova</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mogren</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Hernestal</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Baranov</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2006</pubdate>
            <volume>176</volume>
            <fpage>3585</fpage>
            <lpage>3592</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16517727</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Pregnancy and rheumatic disease: "by the book" or "by the doc"</p>
            </title>
            <aug>
               <au>
                  <snm>Keeling</snm>
                  <fnm>SO</fnm>
               </au>
               <au>
                  <snm>Oswald</snm>
                  <fnm>AE</fnm>
               </au>
            </aug>
            <source>Clin Rheumatol</source>
            <pubdate>2009</pubdate>
            <volume>28</volume>
            <fpage>1</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10067-008-1031-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">18987777</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Role for innate immunity in rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Falgarone</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Jaen</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Boissier</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>Joint Bone Spine</source>
            <pubdate>2005</pubdate>
            <volume>72</volume>
            <fpage>17</fpage>
            <lpage>25</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jbspin.2004.05.013</pubid>
                  <pubid idtype="pmpid" link="fulltext">15681243</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

