For immunohistochemistry on synovial tissue samples, 10 μm cryostat sections were fixed in ice-cold acetone and stained for FN-EDA, FN-EDB, TnC-A1 and TnC-C. These antibodies do not work on freshly frozen paraffin-embedded specimens. Primary antibodies in small immunoprotein (SIP) format were added onto the sections in a final concentration of 2 μg/ml and detected with rabbit anti-human IgE antibody (Dako, Glostrup, Denmark) followed by biotinylated goat anti-rabbit IgG antibody (Biospa, Milan, Italy) and streptavidin-alkaline phosphatase (SAP) complex (Biospa, Milan, Italy). Fast Red TRSalt (Sigma-Aldrich, St Louis, MO, USA) was used as the phosphatase substrate. Sections were counterstained with hematoxylin, mounted with glycergel mounting medium (Dako, Glostrup, Denmark) and analyzed with an Axiovert S100 TV microscope (Zeiss, Feldbach, Switzerland). In total, freshly frozen pathology specimens of seven patients were analyzed by immunohistochemistry.

For immunofluorescence, a double staining for FN-EDA, FN-EDB, TnC-A1 respectively TnC-C and von Willebrand factor was performed. The following primary antibodies were used: scFv(F8), scFv(L19), scFv(F16) resp. scFv(G11) and polyclonal rabbit anti-human von Willebrand factor (Dako, Glostrup, Denmark). As secondary detection antibodies mouse anti-Myc (9E10) monoclonal antibody followed by Alexa Fluor 594 goat anti-mouse IgG (Molecular Probes, Leiden, The Netherlands) was used for scFv and Alexa Fluor 488 goat anti-rabbit (Molecular Probes, Leiden, The Netherlands) for von Willebrand factor. Slides were mounted and analyzed as described before.

The human IL10 gene was amplified from the previously cloned fusion protein L19-IL10 using the following primer sequences: a backward antisense primer, 5' TAATGGTGATGGTGATGGTGGTTTCGTATCTTCATTGTCATGTAGGCTTC-3'; and a forward sense primer, 5'-TTTTCCTTTTGCGGCCGCTCATTAGTTTC-GTATCTTCATTGTCATGTA-3', which appended part of a 15 amino acid linker (SSSSG)₃ at its N-terminus and a stop codon and NotI restriction site at its C-terminus.

The gene for the single-chain variable fragment (F8) was amplified with a signal peptide using the following primer pair: a backward antisense primer, 5'-CCCAAGCTTGTCGACCATGGGCTGGAGCC-3' and a forward sense primer, 5'-GAGCCGGAAGAGCTACTACCCGATGAGGAAGATTTGATTTCCACCTTG-GTCCCTTG-3'. Using this strategy, a HindIII restriction site was inserted at the N-terminus and a complementary part of the linker sequence was inserted at the C-terminus.

The single-chain Fv and IL10 fragments were then assembled using PCR and cloned into the HindIII and NotI restriction sites of the mammalian cell-expression vector pcDNA3.1(+) (Invitrogen, Basel, Switzerland).

TNF receptor (R) II extracellular domain was amplified using a backward antisense primer, 5'-TTTTCCTTTTGCGGCCGCTCATTA-3'; and a forward sense primer, 5'-GGGTAGTAGCTCTTCCGGCTCATCGTCCAGCGGCGTGCCCGCCAAGGTTG-3', which appended part of a 15 amino acid linker (SSSSG)₃ at its N-terminus and a stop codon and NotI restriction site at its C-terminus.

The gene for the single-chain variable fragment (F8) was amplified with a signal peptide using the following primer pair: a backward antisense primer, 5'-CCCAAGCTTGTCGACCATGGGCTGGAGCC-3' and a forward sense primer, 5'-GAGCCGGAAGAGCTACTACCCGATGAGGAAGATTTGATTTCCACCTTG-GTCCCTTG-3'. Using this strategy, a HindIII restriction site was inserted at the N-terminus and a complementary part of the linker sequence was inserted at the C-terminus. The resulting PCR assembly product was cloned into the HindIII and NotI restriction sites of the mammalian cell-expression vector pcDNA3.1(+) expressed in CHO-S cells.

CHO-S cells were stably transfected with the previously described plasmid and selection was carried out in the presence of G418 (0.5 g/l). Clones of G418-resistant cells were screened for expression of the fusion protein by ELISA using recombinant EDA of human fibronectin as antigen and protein A horseradish peroxidase for detection (GE Healthcare, Chalfont St Giles, UK). Following generation of monoclonal cell lines, the best expressing clone was adapted to growth in PowerCHO-2 CD protein-free medium (Lonza, Basel, Switzerland) for large-scale production of F8-IL10. The fusion protein could be purified from cell culture medium by protein A affinity chromatography, because there is a staphylococcal protein A binding site present on most V_H3 subclasses 394041. The size of the fusion protein was analyzed in reducing and nonreducing conditions on SDS-PAGE and in native conditions by fast protein liquid chromatography gel filtration on a Superdex S-200 size exclusion column (GE Healthcare, Chalfont St Giles, UK).

Biological activity of human IL10 was determined by its ability to induce the IL-4-dependent proliferation of MC/9 cells 42 using a colorimetric thiazole blue (MTT) dye-reduction assay (Sigma-Aldrich, St Louis, MO, USA). In a 96-well microtitre plate, 10,000 MC/9 (murine mast cell line) (ATCC-LGC, Molsheim Cedex, France) cells/well in 200 μl of medium containing 5 pg (0.05 units)/ml of murine IL4 (eBiosciences, San Diego, CA, USA) were treated for 48 hours with varying amounts of human IL10. The human IL10 standard and fusion proteins were used at a maximum concentration of 100 ng/ml IL10 equivalents and serially diluted. To this, 10 μl of 5 mg/ml MTT was added and the cells were incubated for three to five hours. The cells were than centrifuged lysed with dimethylsulfoxide (DMSO) and read for absorbance at 570 nm.

Male DBA/1 mice (8 to 10 weeks old) were immunized by intradermal injection at the base of the tail with 150 μg of bovine type II collagen (Chondrex, Inc., Redmond, WA, USA) emulsified with equal volumes of Freund's complete adjuvant (Chondrex, Inc., Redmond, WA, USA). The procedure was repeated two weeks after the first immunization. Mice were inspected daily and each mouse that exhibited erythema and/or paw swelling in one or more limbs was assigned to an imaging or treatment study.

Arthritis was monitored defining a clinical score. Each limb was graded daily in a nonblinded fashion (0 = normal, 1 = swelling of one or more fingers of the same limb and 2 = swelling of the whole paw), with a maximum score of eight per animal 43.

The selective accumulation of SIP(F8) in arthritic mice was tested by near-infrared imaging analysis, as described by Birchler and colleagues 44. Briefly, SIP(F8) was labeled using Alexa750 (Molecular Probes, Leiden, The Netherlands), according to the manufacturer's recommendations, and injected into the tail vein of arthritic mice (n = 3). Mice were anaesthetized using ketamin, 80 mg/kg body weight, and medetomidine, 0.2 mg/kg body weight, and imaged in a near infrared mouse imager 24 hours after injection.

For a more detailed targeting analysis of SIP(F8) and F8-IL10 the proteins were radio-iodinated and injected intravenously or subcutaneously, respectively (150 μg protein, 7 μCi). Mice (n = 2) were sacrificed 24 hours after injection, paws were exposed to a phosphorimager screen (Fujifilm, Dielsdorf, Switzerland) for one hour and read in a PhosphorImager (Fujifilm BAS-5000, Dielsdorf, Switzerland). Data were analyzed using Aida Image Analyzer v.4.15 (Fujifilm, Dielsdorf, Switzerland).

To compare the in vivo targeting performance after subcutaneous and intravenous injection quantitative biodistribution analyses using radiolabeled antibody preparations were performed as described before. Briefly, purified F8-IL10 was radioiodinated with ¹²⁵I and injected intravenously or subcutaneously into 129Sv mice (n = 4) grafted with a subcutaneous F9 tumor (150 μg, 8 μCi per mouse). Mice were sacrificed 24, 48, 72, or 96 hours after injection. Organs were weighed and radioactivity was counted using a Cobra γ counter (Packard, Meriden, CT, USA). Radioactivity content of representative organs was expressed as the percentage of the injected dose per gram of tissue (%ID/g ± standard error).

In a similar experiment a comparison of targeted and systemic application of IL10 was performed. The antibody specific to hen egg lysozyme (HyHel) 10-IL10 and F8-IL10 were labeled with ¹²⁵I and intravenously injected into 129Sv mice (n = 4) grafted with a subcutaneous F9 tumor (150 μg, 8 μCi per mouse). Tumor and organ uptake was measured 24 hours after injection, as described above. Experiments were performed in agreement with Swiss regulations and under a project license granted by the Veterinäramt des Kantons Zürich, Switzerland (169/2008).

Each mouse that exhibited erythema and/or swelling of one or more paws was randomly assigned to a treatment or control group and therapy was started. Mice were given a subcutaneous or intravenous injection of F8-IL10 (3 × 200 μg), saline or an intraperitoneal injection of methotrexate (3 × 100 μg). For the combination study mice were given an intravenous injection of F8-IL10 (3 × 200 μg) followed by an intraperitoneal injection of methotrexate (3 × 100 μg). Eight mice were analyzed per group. The arthritic score was evaluated daily in a nonblinded fashion. The results are displayed as the mean ± standard error for each group. Experiments were performed in agreement with Swiss regulations and under a project license granted by the Veterinäramt des Kantons Zürich, Switzerland (171/2007).

Cloning, expression and purification of an HyHel10-IL10 fusion protein has been described before 18. Therapy was performed as described above. Briefly, arthritis mice were injected subcutaneously with saline, HyHel10-IL10 (200 μg), TNFRII-fusion (100 μg) or F8-IL10 (200 μg). Six to seven mice were analyzed per group. Experiments were performed in agreement with Swiss regulations and under a project license granted by the Veterinäramt des Kantons Zürich, Switzerland (171/2007).

At the end of therapy, mice were killed and paws were embedded in cryombedding compound (Microm, Walldorf, Germany) and stored at -80°C. Sections (10 μm) were cut and fixed in acetone. F8-IL0 and HyHel10-IL10 were detected using a biotinylated anti-human IL10 antibody (eBiosciences, San Diego, CA, USA) followed by SAP complex (Biospa, Milan, Italy). Fast Red TRSalt (Sigma-Aldrich, St Louis, MO, USA) was used as the phosphatase substrate. Sections were counterstained with hematoxylin, mounted with glycergel mounting medium (Dako, Glostrup, Denmark) and analyzed with an Axiovert S100 TV microscope (Zeiss, Feldbach, Switzerland).

To evaluate the role of effector cell responses in vivo immunofluorescent staining of paw sections of therapy mice was performed using antibodies against the following antigens: rat anti-mouse F4/80 (anti-macrophage; Abcam, Cambridge, UK), rat anti mouse CD45 (BD Biosciences, San Jose, CA, USA), rabbit anti-asialo GM1 (anti-NK; Wako Pure Chemical Industries, Tokyo, Japan) and rat anti-mouse CD4 and rat anti-mouse CD8. Cryosections were thawed and fixed by immersion in cold acetone for 10 minutes. Blocking was performed by incubating the sections with 20% donkey/goat serum in PBS for one hour. Following washing with PBS twice for five minutes at room temperature, sections were incubated with the primary antibodies in 12% BSA in PBS over night at 4°C. Sections were washed three times for five minutes with PBS at room temperature and then incubated with fluorescent Alexa 488- or 594-coupled secondary antibodies (BD Biosciences, San Jose, CA, USA) and Hoechst, Frankfurt, Germany (4,6-diamidino-2-phenylindole) in 12% BSA-PBS. Finally, sections were washed three times for five minutes in PBS and mounted with glycergel and a coverglass (VWR International, Dietikon, Switzerland). Images were obtained using the individual fluorescent channels using an Axioskop 2 mot plus (Carl Zeiss, Feldbach, Switzerland).

Staining was quantified in representative 10 times microscopic images using ImageJ software 45 and expressed as a percentage of measurement area.

Levels of anti-bovine collagen-II antibodies at the termination of experiments were determined using standard ELISA techniques as described before 46. Microtiter plates were coated with bovine collagen II solution (5 μg/ml) overnight at 4°C. After washing they were blocked for two hours at room temperature with 2% BSA. Samples were tested in triplicates at 1:800 dilution. Bound total IgG, IgG1 and IgG2a were detected by incubation with horseradish peroxidase conjugated goat anti-mouse IgG/IgG1 or IgG2a antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Mouse plasma cytokine level analysis was performed at Cytolab (Cytolab, Muelligen, Switzerland). A multiplexed particle-based flow cytometric cytokine assay was used 47. MAP Fluorokine cytokine kits were purchased from R&D (Oxon, UK). The procedures closely followed the manufacturer's instructions. The analysis was conducted using a conventional flow cytometer (FC500 MPL, BeckmanCoulter, Nyon, Switzerland).

Preclinical toxicology studies were performed at Centre International de Toxicologie, Evreux, in accordance with good laboratory practice (GLP) guidelines (Study number 34975TSP).

During the study two groups (group 2 and 3) of three male and three female cynomolgus monkeys received test Dekavil (F8IL10) by subcutaneous injection in the dorsum at the dose-level of 180 μg/kg/administration, three times a week for eight weeks. Another group (group 1) of three males and three females received the formulation buffer for Dekavil (F8-IL10), under the same experimental conditions, and acted as a control group.

Animals in group 3 were also administered methotrexate starting on day 4, as well as folic acid 24 hours after each methotrexate administration. Both these test items were administered by oral gavage with capsules, once a week until the end of the study.

Blood samples were taken from all the animals for determination of serum levels of Dekavil (F8IL10) on day 1 and on the last day of dosing, at designated time-points.

Animals were checked daily for reaction to treatment and the following investigations were performed: body weight, food consumption, ophthalmoscopy, electrocardiography, blood pressure, hematology and clinical chemistry.

On completion of the treatment period, animals were sacrificed and submitted to a complete macroscopic examination.

Single dose toxicity study was performed at the Research Toxicology Center in Rome, Italy, in accordance with GLP guidelines (Study number 74250).

A single group of five male and five female mice (Hsd:ICR(CD-1)) was intravenously injected with 20 mg/kg F8-IL10 followed by a 14-day observation period. A control group of five male and five female mice (Hsd:ICR(CD-1)) was injected with the vehicle alone (saline). All animals were killed with carbon dioxide at the end of the observation period and subjected to necropsy.

Data are expressed as the mean ± standard error of the mean. Differences in the arthritis score between different groups were compared using Mann-Whitney test.

Figure 1 presents a comparative immunohistochemical and immunofluorescence analysis of the human monoclonal antibodies L19, G11, F16 and F8. In total, pathology specimens of seven patients were analyzed, four of which are shown in Figure 1. Both F16 and F8 displayed a stronger staining pattern compared with L19 and G11. The F8 antibody sometimes exhibited a diffuse stromal staining or a vascular staining pattern, but consistently reacted strongly with both human and murine specimens of arthritis and was thus selected for pharmacodelivery applications. Furthermore, F8 and F16 exhibited a prominent perivascular staining pattern in tissue specimens from patients suffering from psoriatic arthritis and osteoarthritis. In tumor-bearing mice, the in vivo targeting potential of F8 and L19 was comparable when assessed by quantitative biodistribution studies 38.

The immunocytokine F8-IL10 was cloned in a mammalian expression vector by sequentially fusing the F8 in scFv format 1938 in frame with the human IL10 gene, using flexible aminoacid linkers (Figure 2a). The resulting plasmid pKS1 was linearized and used to stably transfect CHO-S cells. A short five amino acid linker was used to bridge VH and VL domains within the scFv antibody fragment moiety, thus driving the formation of a stable non-covalent homodimer (Figures 2b and 2c) 20. F8-IL10 could be purified to homogeneity on protein A (Figures 2b and 2c), retained full immunoreactivity when tested by affinity chromatography on an EDA-sepharose resin (data not shown) and displayed a biological activity comparable with that of recombinant human IL10 used in equimolar amounts in a MC/9 cell proliferation assay (Figure 2d) 42. In a crossreactivity study on tissue microarray none of the healthy tissue sections showed any staining with F8-IL10, except for ovary (1/3), placenta (3/3) and uterus (2/3) [see Additional data file 1]. This finding is in excellent agreement with the known expression of oncofetal antigens in organs of the female reproductive system 48.

The in vivo targeting properties of the F8 antibody and of F8-IL10 were tested in CIA mice, using both fluorescently labeled and radioiodinated protein preparations. Figure 3a shows near-infrared fluorescence images 4449 of arthritic mice 24 hours after intravenous injection of 100 μg SIP(F8) 3850 labeled with Alexa750 dye. A preferential accumulation of the F8 antibody could be detected in the inflamed extremities. A more detailed targeting analysis was obtained using ¹²⁵I-labeled preparations of SIP(F8) and of F8-IL10. Twenty-four hours after intravenous or subcutaneous administration, arthritic limbs were imaged on a PhosphorImager, revealing a preferential protein accumulation at arthritic fingers and paws compared with healthy control paws (Figures 3b and 3c). The ranges of lesion to nonaffected paw ratios measured by phosphorimaging were 7.4 to 13.9 for SIP(F8) intravenous and 5.0 to 6.8 for F8-IL10 subcutaneous. The administration of comparable amounts of antibodies of irrelevant specificity in the mouse in recombinant SIP format did not exhibit any preferential uptake at sites of inflammation 51.

The subcutaneous administration of therapeutic proteins in patients with arthritis is often preferable compared with the intravenous administration route, which is typically performed at the hospital. In order to investigate whether a selective in vivo targeting of lesions could be obtained using F8-IL10 both with subcutaneous and intravenous administrations, we performed a comparative biodistribution study in tumor-bearing mice. We chose a cancer model rather than an arthritis model for this analysis, because tumor-bearing mice provide a quantitative biodistribution analysis of therapeutic proteins. Figure 4a illustrates biodistribution results (expressed as a percentage of injected dose per gram of tissue) for a radioiodinated preparation of F8-IL10, administered intravenously or subcutaneously. For both administration routes, a preferential tumor uptake could be observed, with excellent tumor:organ ratios at 24 and 48 hours following injection. An antibody-IL10 fusion protein of irrelevant specificity in the mouse 15052 exhibited a reduced tumor uptake in the same animal model (Figure 4b). In order to quantitatively assess the residence time of F8-IL10 on neovascular lesions following subcutaneous administration, a biodistribution study was performed sacrificing tumor-bearing mice at 24, 48, 72 and 96 hours and correcting for the tumor volume increase during the study period. Figure 4c shows that the immunocytokine efficiently and stably localized at the tumor site, while being cleared from all normal organs. No statistically significant difference could be observed in terms of tumor uptake between the 48 and 96 hour time points.

The CIA model was used to assess the therapeutic potential of F8-IL10 when used alone or in combination with methotrexate. Mice were allowed to reach an arthritic score of 1 to 3, before receiving three injections (days 1, 4 and 7) of F8-IL10 (200 μg) and/or of methotrexate (100 μg). The F8-IL10 dose for the mouse was calculated from the recommended equivalent dose of 20 μg/kg of recombinant human IL10 used in clinical trials using a body surface correction algorithm 53 and a correction factor for the activity of human IL10 in mice 29.

Figure 5a shows that mice treated with methotrexate did not exhibit any detectable reduction of arthritis, in line with previously published results where comparable doses of methotrexate in the same mouse model had no significant effect on the onset of CIA 54. Disease progression was substantially inhibited for F8-IL10 with intravenous administration and with subcutaneous administration. Both subcutaneous injections of F8-IL10 and the combination treatment of methotrexate plus intravenous F8-IL10 allowed the maintainence of an arthritic score below 3 until the mice were sacrificed (18 days after the beginning of pharmacological treatment). Similar to what has previously been reported 18, the therapeutic performance of an antibody-IL10 fusion protein of irrelevant specificity in the mouse exhibited a worse therapeutic benefit, confirming the contribution of selective targeting to therapeutic outcome (Figure 5b). We were not allowed by the local authorities (Veterinäramt des Kantons Zürich) to extend the duration of the observation period for the mice in order to keep animal discomfort within an acceptable limit, but it would have obviously been of scientific interest to monitor disease stabilization over a longer period of time.

Paws and blood of mice were analyzed at the end of the therapy and we could demonstrate by immunohistochemistry that F8-IL10 is still detectable in arthritic paws (Figure 5c). Analysis of plasma cytokines of sacrificed mice showed significantly (P = 0.004) decreased IL6 levels for F8-IL10-treated mice (Figure 5d). Furthermore, saline-treated mice showed elevated IL1b levels compared with healthy control and F8-IL10-treated mice. In our mouse model of CIA, the therapeutic activity of F8-IL10 was found to be comparable with the one of a recombinant biopharmaceutical based on the extracellular part of murine TNF receptor 2, administered with the same schedule (Figure 5b).

Figure 6 shows a comparative immunofluorescence analysis of infiltrating cells from mice treated with saline or F8-IL10. Staining with an anti-CD45 antibody revealed that F8-IL10-treated mice presented a significantly (P = 0.03) lower level of infiltrating leukocytes in the paw compared with the saline treatment group. In accordance with this finding, staining with an anti-asialo-GM1 antibody, which preferentially stains natural killer cells, with the macrophage-specific antibody F4/80 and with CD4/CD8 antibodies, showed a decreased infiltration of these cells in paws of F8-IL10-treated mice.

Humoral immunity was followed by measurement of serum levels of anti-collagen II immunoglobulin (Ig) isotypes. Serum samples were obtained from both control and F8-IL10-treated animals at the termination of the experiment and total IgG antibody levels, as well as IgG1 and IgG2a isotype levels were determined by ELISA (Figure 5e). Total IgG levels were significantly lower in F8-IL10-treated animals than in controls (P < 0.05). When analyzing specific isotypes, no significant differences were seen in the anti-collagen II IgG1 levels between the two groups. However, the anti-collagen II IgG2a titers were significantly lower (P < 0.05) in sera from F8-IL10-treated mice, as seen for other anti-arthritic therapeutic interventions in the CIA model 55.

In preparation for a dose-finding, pharmacokinetic phase I study of F8-IL10 in combination with methotrexate in patients with active rheumatoid arthritis we performed a toxicity assessment of F8-IL10 in combination with methotrexate in cynomolgus monkeys. In this study, three groups of monkeys (each group consisting of three female and three male animals) received administrations of either F8-IL10 alone, F8-IL10 plus methotrexate or saline. During the study F8-IL10 was injected subcutaneously three times a week for eight weeks at a dosage of 180 μg/kg (60 μg/kg IL10 equivalents), which reflects 10 times the initial human dose intended for administration during the phase I clinical study. Methotrexate was given on a weekly basis at the standard dosage of 0.65 mg/kg.

There were no relevant findings in body weight evolution, food consumption, quantitative electrocardiography parameters or systolic and diastolic blood pressure values. No relevant ophthalmological findings were noted in any groups. A ventricular premature complex was recorded in one female treated with F8-IL10 alone in week 4, after treatment.

During the course of the study (week 4), a regenerative anemia was observed, however a complete recovery was noted in week 7. No toxicologically relevant findings were observed in the blood biochemical parameters at the end of week 4 and at the end of the treatment period in any groups.

Pharmacokinetic data were obtained during the toxicology study. Blood samples were collected at pre-dose, 5 and 30 minutes, and 3 and 24 hours after the injection. The serum concentration of F8-IL10 was measured using a validated colorimetric ELISA. Many of the samples analyzed were found to be below the level of quantification (< 0.25 ng/ml). However, for those samples in which a positive result was obtained, maximum serum levels were generally observed three hours after the subcutaneous injection of F8-IL10 with serum levels of about 20 ng/ml. After 24 hours no more detection of F8-IL10 in serum was possible.

In conclusion, subcutaneous administration of F8-IL10 alone or in combination with methotrexate was generally well tolerated.

The acute toxicity of F8-IL10 was investigated in mice after intravenous administration of a single dose level of 20 mg/kg, corresponding to 300 times the human starting dose proposed for clinical trials 53, followed by a 14-day observation period. Body weights were recorded weekly and necropsy was performed on all animals. No mortality occurred and no clinical signs were noted in both male and female animals. Changes in body weight observed at the end of the study were within the expected range for this strain and age of animals. No changes of toxicological significance were observed in the weight of organs. No abnormalities were detected in all treated animals at the necropsy examination and no abnormalities were observed at the injection site.

These results indicate that F8-IL10 had no toxic effect on mice following a single intravenous administration at a dose level of 20 mg/kg body weight. The product was well locally tolerated when injected into the tail vein at the dose level tested.